Research Article
Quantification of Pregenomic RNA and Covalently Closed Circular DNA in Hepatitis B Virus-Related Hepatocellular Carcinoma
Table 1
Sequences and positions of primers and probes used in this study.
| Primer and probe | Region | Position | Polarity | Sequence (5′ to 3′) | Reference |
| Occult case determination | | | | | | HBV 1 | PreS-S | 2815–2834 | Sense | GGTCACCATATTCTTGGGAA | [6] | HBV 2 | PreS-S | 690–671 | Antisense | AATGGCACTAGTAAACTGAG | [6] | HBV 17 | PreS-S | 3037–3057 | Sense | AATCCAGATTGGGACTTCAA | [6] | HBV 4 | PreS-S | 459–440 | Antisense | CCTTGATAGTCCAGAAGAAC | [6] | HBV 5 | Precore-core | 2021–2040 | Sense | GCCTTAGAGTCTCCTGAGCA | [6] | HBV 6 | Precore-core | 2464–2448 | Antisense | GTCCAAGGAATACTAAC | [6] | HBV 7 | Precore-core | 2048–2066 | Sense | CCTCACCATACTGCACTCA | [6] | HBV 8 | Precore-core | 2385–2366 | Antisense | GAGGGAGTTCTTCTTCTAGG | [6] | Pol 1 S | Polymerase | 2412–2430 | Sense | CGCGTCGCAGAAGATCTCA | [5] | Pol 1 AS | Polymerase | 256–237 | Antisense | CGAGTCTAGACTCTGTGGTA | [5] | Pol 2 S | Polymerase | 2452–2476 | Sense | GTATYCCTTGGACTCATAAGGTGGG | [5] | Pol 2 AS | Polymerase | 2838–2814 | Antisense | CTTGTTCCCAAGAATATGGTGACCC | [5] | X 1 S | X | 1100–1121 | Sense | CGCCAACTTACAAGGCCTTTCT | [5] | HBV 19 | X | 1550–1529 | Antisense | CGTTCACGGTGGTCTCCAT | [6] | HBV 15 | X | 1380–1400 | Sense | GCTAGGCTGTGCTGCCAACTG | [6] | HBV 21 | X | 1518–1497 | Antisense | GGTCGGTCGGAACGGCAGACGG | [6] | Genotyping and amplification of “a” determinant region | | | | | | HB2F | S | 414–433 | Sense | TGCTGCTATGCCTCATCTTC | [7] | HB2R | S | 989–970 | Antisense | CATACTTTCCAATCAATAGG | [7] | Amplification of core promoter and precore regions | | | | | | HB7F | C | 1611–1630 | Sense | GAGACCACCGTGAACGCCCA | [7] | HB7R | C | 2072–2048 | Antisense | CCTGAGTGCTGTATGGTGAGG | [7] | cccDNA and pgRNA quantification | | | | | | CCC | X/C | 1555–1573 | Sense | GTGCCTTCTCATCTGCCGG | [8] | PGP | X/C | 1826–1843 | Sense | CACCTCTGCCTAATCATC | [8] | BC1 | X/C | 1974–1955 | Antisense | GGAAAGAAGTCAGAAGGCAA | [8] | hbvLC | C | 1874–1848 | Antisense | GGAGGCTTGAACAGTAGGACATGAAC | [8] | hbvFL | C | 1897–1876 | Antisense | CYAAAGCCACCCAAGGCACAGC | [8] |
|
|