International Journal of Hypertension / 2012 / Article / Tab 1

Research Article

Investigation of Homocysteine-Pathway-Related Variants in Essential Hypertension

Table 1

SNP and assay information.

GeneLocationrs numberSNPAA changeAssayPrimer sequenceProduct sizeEnzymeDigest fragment

MTHFR1p36.3rs1801133C677TA222VPCR-RFLPFWD: 5′ TGAAGGAGAAGGTGTCTGCGGGA 3′198 bpHinfIC-198 bp
REV: 5′ AGGACGGTGCGGTGAGAGTG 3′T-175 bp and 23 bp
MTHFR1p36.3rs1801131A1298CE429AHRMFWD: 5′ CTTTGGGGAGCTGAAGGACTACTAC 3′163 bpN/AN/A
REV: 5′ CACTTTGTGACCATTCCGGTTTG 3′
MTRR5p15.31rs1801394A66GI22MHRMFWD: 5′ GCAAAGGCCATCGCAGAAGACAT 3′118 bpN/AN/A
REV: 5′ AAACGGTAAAATCCACTGTAACGGC 3′
MTHFD114q24rs2236225G1958AR653QHRMFWD: 5′ CATTCCAATGTCTGCTCCAA 3′254 bpN/AN/A
REV: 5′ GTTTCCACAGGGCACTCC 3′

AA: amino acid; PCR-RFLP: polymerase chain reaction-restriction fragment length polymorphism; HRM: high resolution melt.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.