International Journal of Microbiology

International Journal of Microbiology / 2020 / Article

Research Article | Open Access

Volume 2020 |Article ID 5961521 | https://doi.org/10.1155/2020/5961521

Benjelloun Touimi Ghita, Laila Bennani, Sanae Berrada, Moussa Benboubker, Bahia Bennani, "Molecular Serotyping and Antibiotic Resistance Patterns of Escherichia coli Isolated in Hospital Catering Service in Morocco", International Journal of Microbiology, vol. 2020, Article ID 5961521, 8 pages, 2020. https://doi.org/10.1155/2020/5961521

Molecular Serotyping and Antibiotic Resistance Patterns of Escherichia coli Isolated in Hospital Catering Service in Morocco

Academic Editor: Todd R. Callaway
Received12 Jan 2020
Accepted31 Jul 2020
Published19 Aug 2020

Abstract

Escherichia coli is related to foodborne disease and outbreaks worldwide. It mainly affects persons at high risk as newborns, infants, and individuals with impaired immune system in hospitals. Multidrug-resistant E. coli is currently spreading both in community and hospital settings. Our study aims to evaluate the presence of E. coli and the incidence of its antibiotic resistance in samples obtained from various cooked and raw foods (N = 300), food contact surfaces (N = 238), and food handlers (N = 40) in Moroccan hospital catering service. E. coli was identified using API 20E, and the antibiotic resistance patterns were obtained using the agar disk diffusion methods. However, PCR method was used for O157 and H7 typing. The samples analysis showed that 14.33%, 24.16%, and 45% of food, surfaces, and food handlers harbored E. coli, respectively, with the highest rates obtained in raw meats (34.88%) and salads (34.88%). Molecular amplification shows that 14 E. coli isolates carried the flagellar antigen H7, while there are no isolates showing amplification for O157. The high rate of resistance was noted against ampicillin (100%), amoxicillin-clavulanate acid (100%), nalidixic acid (61.62%), and cefotaxime (59.49%), and isolates obtained from food handler’s hands showed the highest rates of resistance. None of the isolates are extended-spectrum beta-lactamases producing, while 27.7% of the isolates were metallo-beta-lactams producing. This first study conducted on Moroccan hospital catering services may draw the authorities’ attention to the necessity of setting up a surveillance system to monitor the food preparation process and the safety of prepared food in healthcare settings.

1. Introduction

Escherichia coli (E. coli) is facultative anaerobic, non-spore forming, Gram-negative bacteria within the Enterobacteriaceae family. It forms part of the humans and warm-blooded animals natural gastrointestinal flora [1, 2]. Although most E. coli are harmless commensal organisms [3], several pathogenic strains can cause a variety of diseases. There are six pathogenic groups with different virulence traits and mechanisms of pathogenicity [4]. Diarrheagenic E. coli O157:H7 is a common serotype [5] and the main cause of foodborne disease and outbreaks worldwide. It represents a risk to global food safety and public health [6] primarily for persons at high risk as newborns, infants, and individuals with compromised immune system [2].

Besides their pathogenesis and virulence, E. coli strains also acquire resistance over time. Mobile DNA elements, temperate bacteriophage, and transmissible plasmid have all served as carriers for antibiotic resistance genes in E. coli [7]. In fact, E. coli belongs to the group I enterobacteria, characterized by a phenotype naturally sensitive to all β-lactams. It is also naturally sensitive to other classes of antibiotics including aminoglycosides, quinolones, sulfonamides, trimethoprim, tetracycline, and chloramphenicol. However, this bacterium is a good example of antibiotic resistance evolution, and multidrug-resistant (MDR) strains are currently spreading in both community and hospital settings [8]. Due to their ubiquity and infections frequency, the spread of MDR E. coli is of great concern to the medical community [7]. Therefore, MDR bacteria contaminated food could be a serious threat to consumer health especially to vulnerable patients in hospitals [9, 10] who are highly disposed to infection due to their illness, treatment, or their compromised immune system [7, 11]. Hence, several epidemiological studies have shown the correlation between increased morbidity and mortality with resistant foodborne pathogens infections [12, 13]. Thus, nosocomial foodborne infections prevention is essential, and implementing a surveillance system in healthcare setting is required.

There are few data on the prevalence and antimicrobial resistance of E. coli in food, food surfaces, and food handlers in Morocco. This is the first study that evaluates the presence of E. coli and O157:H7 serotype and determines their antibiotics resistance in a Moroccan hospital kitchen environment (food, food contact surfaces, and food handlers (hand carriage)).

2. Materials and Methods

2.1. Study Design

This study was conducted in a hospital food service in Morocco that produces more than 1000 meals per day to serve patients and medical staff. E. coli detection was performed on food, food contact surfaces, utensils, and hand samples among food handlers.

2.2. Sample Collection

A total of 608 samples were collected from May 2015 till June 2016. They were 300 food samples, 238 surfaces and utensils samples, and 40 hand samples. Food samples were collected aseptically using sterile spoons and placed into Stomacher bags (Grade, UK). The targeted surfaces and an area ranging from 20 to 100 cm2 (according to the dimension of the surface to be sampled) were swabbed by sterile cotton swabs (Oxoid, UK), premoistened into a 2 mL sterile Brain heart Infusion solution (Oxoid, UK) then transported to the laboratory in ice boxes (4°C) [14]. The biological samples were collected from bare-hand food handlers using swabs as recommended by Evancho et al. [15]. All samples were obtained during the food preparation process.

2.3. E. coli Isolation and Identification

Twenty-five grams of each samples was homogenized with 225 mL of sterilized peptone water. 1 mL aliquots of the homogenate was inoculated into 15 mL of Violet Red Bile Lactose Agar (Biokar Diagnostics, France) then incubated for 24 h at 37°C. The presumptive colonies were streaked into eosin methylene blue agar (Biokar Diagnostics, France). E. coli identification was based on morphological, microscopic characteristics and biochemical assays, including gram straining, oxidase, indole, fermentation, citrate degradation, then confirmed by API 20E kit (BioMerieux, France).

2.4. Molecular Detection of fliCH7 and rbfO157 Genes in the Isolated Strains

Molecular serotyping was performed on all E. coli isolates using PCR to detect the serogroup O157 and the H7 antigen (Table 1). The obtained PCR products were sequenced using an ABI PRISM 3130DNA Analyzer and the data were processed with the Sequencing Analysis 3.3 software (Applied Biosystems).


Amplified regionsPrimersSequences (5′-3′)Size (Pb)Reference

fliCH7Flic FFGCGCTGTCGAGTTCTATCGAGC625[16]
Flic RCAACGGTGACTTTATCGCCATTCC

rfbO157O157 FCGGACATCCATGTGATATGG256[17]
O157 RTTGCCTATGTACAGCTAATCC

2.5. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility was determined using disk diffusion method on Muller–Hinton agar (Biokar Diagnostics, France) and interpreted according to the European Committee on Antimicrobial Susceptibility recommendations [18]. The tested antibiotics (Oxoid, UK) were ceftazidime (30 μg), cefotaxime (30 μg), trimethoprim-sulfamethoxazole (25 μg), gentamicin (30 μg), ciprofloxacin (30 μg), amikacin (30 μg), ampicillin (10 µg), amoxicillin-clavulanic acid (20/10 µg), and imipenem (10 μg).

2.6. Phenotypic Detection of Extended-Spectrum Beta-Lactamases (ESBL) and Metallo-Beta-Lactamases (MBL)

ESBL presence was checked by double-disk synergy test. It was performed on agar with 30 µg disk of cefotaxime, ceftazidime and a disk of amoxicillin-clavulanate (20 µg/10 µg) positioned at a distance of 30 mm. The test was considered positive when a decreased susceptibility to cefotaxime combined with a clear-cut enhancement of the inhibition zone in front of the clavulanate-containing disk was observed [19].

EDTA disk synergy test was used to detect metallo-beta-lactamases (MBL) activity. A suspension of E. coli (0.5 McFarland) was swabbed over Mueller–Hinton agar (Biokar Diagnostics, France) surface. After drying, an imipenem disk (10 µg) (Oxoid, UK) and a blank filter paper disk were placed 10 mm apart from edge to edge; then 10 µL of 0.5 M EDTA solution was added to the blank disk. After overnight incubation, the presence of an expanded inhibition zone was interpreted as EDTA synergy test positive [20].

3. Results

3.1. E. coli Prevalence

The samples’ bacteriological analysis shows that 14.33% of food samples harbored E. coli (Table 2). The highest rates were isolated in raw meats (34.88%) and salads (34.88%), while the lowest rates were obtained in the hot meals (9.31%) and pastries. Regarding the utensils and food contact surfaces, the raw meats worktops were the most contaminated with a rate of 59.09%, whereas the pastries worktops were exempts from E. coli. However, E. coli was detected in 45% of the examined food handler’s samples.


SamplesSamples collected (N)Positive samples N (%)

Food samples
Raw meats3915 (34.88)
Raw vegetables337 (16.27)
Hot meals1504 (9.31)
Salads5415 (34.88)
Pastries242 (4.66)
Total30043 (14.33)

Surfaces and utensils
Chopping meat devise2612 (46.15)
Knives102 (2)
Weighing machine162 (12.5)
Sink208 (20)
Recipient383 (7.89)
Baking stainless steel worktop300
Serving meals worktop301 (3.33)
Raw meat cutting boards4426 (59.09)
Vegetables cutting boards244 (16.66)
Total23858 (24.16)

Hand carriage4018 (45)

3.2. E. coli O157 H7 Molecular Serotyping

Molecular amplification shows that 14 E. coli isolates carried the flagellar antigen H7. However, no isolates show amplification for O157. Thus, haemorrhagic E. coli O157:H7 was not detected in any of the examined samples (Table 3).


N (%)
SamplesfliCH7rfbO157

Food (n = 300)9 (3)ND
Food contact surfaces (n = 208)3 (1.25)
Hand carriage (n = 40)2 (5)

Total14 (2.41%)

3.3. Antibiotic and Resistance Profiles of Isolated Strains

Overall, the highest resistance rates were shown against ampicillin and amoxicillin-clavulanate acid (100%), nalidixic acid (61.62%), and cefotaxime (59.49%). As reported in Table 4, the isolates obtained from food handler’s hands showed the highest numbers of resistance among all the other strains. From food and food contact surfaces samples, the highest rates of resistance were observed in isolates obtained from raw meats and sinks, respectively. The ESBL-producing E. coli detection was performed on isolates with decreased resistance to third-generation cephalosporins. The results show that none of the tested isolates produced an extended-spectrum β-lactamase (ESBL). However, 27.7% of the isolates were carbapenemase producing (MBL).


SamplesPrevalence of phenotypic resistance (%)MBLESBL
AMPAMCCNSXTNAIPMCAZCFMPN

Food samplesRaw meats10010053.346.753.36053.36033.366.7ND
Raw vegetables10010042.942.985.714.357.157.1NDND
Hot meals1001007525507550752575ND
Salads10010046.766.76046.746.7402080ND
Pastries100100500100100050NDND

Food contact surfacesChopping meat devise10010058.3505058.350502575ND
Knives100100100505050100100NDND
Weighing machine10010000005050NDND
Sink100100100071.485.757.771.428.671.4ND
Recipient100100010010010033.350NDND
Baking worktops100100000000NDND
Serving meals worktops1001005050507550100NDND
Raw meat cutting boards10010069.246.265.450505023.196.1ND
Vegetables cutting boards1001005050100505050NDND
Hand carriage10010010055.688.977.894.488.938.961.1ND
Total10010010035.5461.625149.559.4927.772.3ND

ATB: antibiotic; ND: not detected; P: positive; N: negative; AMP: ampicillin; CN: gentamicin; SXT: trimethoprim-sulfamethoxazole; NA: nalidixic acid; IPM: imipenem; CAZ: ceftazidime; CFM: cefotaxime; MBL: metallo-beta-lactamases; and ESBL: extended-spectrum beta-lactamases.

As reported in Table 5, the E. coli isolated strains show a high resistance to the most tested antibiotics. A total of 44 multiresistance profiles were determined. For food samples, 28 profiles were determined with a predominance of the profile “AMC. AMP. CN. SXT. NA. IPM. CAZ” resistants, while the food contact surfaces harbored 7 profiles with a predominance of the profile “AMC. AMP. CN. SXT. NA. IPM. CAZ. CFM” resistants. Additionally, 28 profiles were detected in the staff hands with a predominance of the profile “AMC. AMP. CN. SXT. NA. IPM. CAZ. CFM” resistants.


ProfileN (%)
FoodFood contact surfacesHand carriage

2 ATB1AMC. AMP-2 (3.4)

3 ATB2AMC. AMP. CN1 (5.6)
3AMC. AMP. NA1 (1.7)
4AMC. AMP. SXT1 (2.3)
5AMC. AMP. IPM2 (4.7)1 (1.7)
6AMC. AMP. CAZ4 (6.9)
7AMC. AMP. CFM3 (5.2)

4 ATB8AMC. AMP. CN. NA1 (2.3)
9AMC. AMP. NA. IPM1 (2.3)
10AMC. AMP. NA. CAZ1 (1.7)
11AMC. AMP. IPM. CAZ1 (2.3)
12AMC. AMP. IPM. CFM1 (1.7)
13AMC. AMP. CAZ. CFM3 (7)3 (5.2)

5 ATB14AMC. AMP. CN. SXT. NA1 (2.3)3 (5.2)
15AMC. AMP. CN. NA. IPM1 (2.3)
16AMC. AMP. CN. NA. CAZ2 (4.7)
17AMC. AMP. CN. SXT. IPM2 (4.7)1 (1.7)
18AMC. AMP. SXT. NA. IPM1 (1.7)
19AMC. AMP. CN. SXT. CFM3 (7)
20AMC. AMP. CN. IPM. CFM1 (1.7)
21AMC. AMP. CN. CAZ. CFM2 (4.7)4 (6.9)
22AMC. AMP. NA. CAZ. CFM1 (2.3)
23AMC. AMP. NA. IPM. CFM1 (2.3)
24AMC. AMP. SXT. NA. CFM2 (4.7)
25AMC. AMP. IPM. CAZ. CFM1 (5.6)1 (1.7)

6 ATB26AMC. AMP. CN. NA. CAZ. CFM1 (5.6)
27AMC. AMP. CN. NA. IPM. CAZ1 (5.6)3 (5.2)
28AMC. AMP. CN. NA. IPM. CFM1 (2.3)3 (5.2)
29AMC. AMP. CN. SXT. NA. IPM2 (4.7)3 (5.2)
30AMC. AMP. CN. SXT. NA. CAZ1 (2.3)1 (1.7)
31AMC. AMP. CN. SXT. NA. CFM1 (2.3)2 (3.4)
32AMC. AMP. CN. SXT. IPM. CAZ1 (1.7)
33AMC. AMP. SXT. NA. IPM. CFM2 (4.7)
34AMC. AMP. NA. IPM. CAZ. CFM2 (4.7)
35AMC. AMP. CN. IPM. CAZ. CFM1 (2.3)
36AMC. AMP. SXT. NA. CAZ. CFM1 (2.3)1 (5.6)
37AMC. AMP. SXT. IPM. CAZ. CFM1 (2.3)

7ATB38AMC. AMP. CN. SXT. NA. IPM. CAZ4 (9.3)3 (5.2)
39AMC. AMP. CN. SXT. NA. IPM. CFM1 (2.3)1 (1.7)
40AMC. AMP. CN. NA. IPM. CAZ. CFM3 (16.7)1 (1.7)
41AMC. AMP. CN. SXT. NA. CAZ. CFM1 (2.3)2 (3.4)
42AMC. AMP. CN. SXT. IPM. CAZ. CFM1 (1.7)
43AMC. AMP. SXT. NA. IPM. CAZ. CFM1 (2.3)1 (5.6)2 (3.4)
8 ATB44AMC. AMP. CN. SXT. NA. IPM. CAZ. CFM9 (50)8 (13.8)

-: absent; AMP: ampicillin; CN: gentamicin; SXT: trimethoprim-sulfamethoxazole; NA: nalidixic acid; IPM: imipenem; CAZ: ceftazidime; and CFM: cefotaxime.

4. Discussion

E. coli is foodborne pathogen identified in food products, human, and environmental samples worldwide [2, 21]. Several studies showed and documented an increase in its drug resistance during the last decades [2224]. The aim of the present study is to provide an informative basis on the E. coli prevalence and its antibiotic resistance profiles in food (raw and cooked), food contact surfaces and its carriage among food handlers in hospital catering service in Morocco. As far as we know, the present investigation is the first one conducted on a hospital catering service in this country.

The microbiological analysis demonstrated that 14.33% of food samples harbored E. coli. This rate is higher than the one found in Iranian hospital (6.71%) [10]. This high prevalence could be related to the long-process food production, the inadequate washing of raw materials, inadequate cooking process, and the nonrespect of the freezing/cooling temperatures [9, 10].

The highest rates of E. coli were detected in raw meats (34.88%) and salads (34.88%) compared to hot meals (9.31%) and pastries (4.66%). A similar tendency was reported in an Iranian study with rates of 20% and 6% in raw meats and cooked meals, respectively [10]. The high rates of raw meats harboring E. coli could be related to one or multiple factors: (i) the meats autocontamination during slaughter as E. coli is a normal part of the intestinal microflora of many animals; (ii) the inadequate hygienic conditions in slaughterhouses; (iii) the inappropriate storage temperature specially that meat is a favorable medium to rapid development of bacteria [25, 26].

The high rates of E. coli in salads and raw vegetables can be related to an enteric contamination before product harvesting, a nonhygienic handling process and/or a contamination during the distribution process [27].

Regarding the utensils and food contact surfaces, the raw meats cutting boards were the most contaminated with a rate of 59.09%. This rate is still lower than that reported in a Brazilian hospital (90%) [28]. In fact, several studies demonstrated that these utensils present high microbial counts due to cross-contamination [29] and are influenced by the raw nature of handled materials and the surface material type (wood, stainless steel, plastic, etc.). Hence, the presence of E. coli in most food surfaces can be attributed to cross-contamination between food materials and these food contact surfaces and the subsequent growth of microorganisms in biofilms [30, 31]. In fact, bacteria as E. coli have a strong capacity of forming biofilms which are characterized by their high resistance to antibiotics and to environmental stresses [32]. Klontz et al. described that 25% of food workers reported to reutilize cutting boards without cleaning after cutting raw chicken [33]. So, the lack of adequate food safety knowledge among food handlers [3] and the inadequate food contact surfaces cleaning and sanitizing as well as the overall sanitary conditions of food preparation in this facility can endorse the accumulation of food debris and bacteria in biofilms on surfaces.

The E. coli carriage among food handlers was observed in 45% of cases. Our result is similar to that of an Egyptian investigation reporting that 41% of food workers were carrying E. coli in their hands [34] but higher than the rates found in Malaysia (14.20%) [35]. The food service employees’ hands are considered as vectors of foodborne disease spread, mainly because of poor personal hygiene. In fact, it was proved that inappropriate food handler practices contributed to approximately 97% of foodborne illnesses in food service establishments [36]. Thus, hand washing is a fundamental precautionary measure to protect against the infection spread and is one of the primary practices for reducing the bacteria transfer [3739].

In the present study, haemorrhagic E. coli O157:H7 has not been detected; H7+ non-O157 strains were isolated with a low rate (2.41%). This result is similar to those reported in Moroccan study conducted on several food types (5%) [40]. However, E. coli non-O157 have more recently been recognized as important pathogens with an increasing impact on human health and are now also considered as major cause of disease [41]. Its virulence, arises from Shiga (Vero) toxins-production coded by Shiga toxin genes (stx1 and stx2), which are the primary factor responsible for the haemorrhagic aspect of the diarrhea and systemic complications [42]. In this study, and in spite of the limitation related to the nondetermination of Shiga toxin genes presence, the detection of E. coli non-O157 in the food designated to vulnerable patients constitutes a high risk. The systematic detection of this species must be recommended routinely in this setting.

Moreover, E. coli antibiotic resistance is a topic that is continuously reviewed, and multiple studies are published every year with new data on antimicrobial resistance genes acquisition. Even if the emergence of new strains capable of hydrolyzing new generation of cephalosporins and β-lactams is common among E. coli isolated from foods [21, 22], the antibiotic resistance of strains isolated in hospital food have not been studied widely.

In this investigation, all isolates were resistant to ampicillin and amoxicillin and highest rates of resistance were obtained against nalidixic acid (61.62%) and cefotaxime (59.49%). These rates are consistent with those reported by Ranjbar et al. in E. coli isolated from hospital food [9, 10]. In fact, isolates obtained from raw meats showed the highest rates of resistance to the tested antibiotics among all food sample types. This result was not surprising since a previous study conducted in Morocco shows that raw chicken harbored a high resistance against amoxicillin (90.9%) [43]. Such resistance can be related to the use of these antibiotics in livestock either as therapeutic or preventive molecules. In fact, for economic reasons, the use of those antibacterial growth promoters is permitted and leads to an increase of antimicrobial resistance risks. Knowing that E. coli had high ability to exchange genetic material, the use of tetracycline and ampicillin in livestock (as is the case in Morocco) helps to resist spread [44, 45].

The isolates obtained from food handler’s hands showed the highest rates of resistance among all the other isolates. This result corroborates the results of studies concluding that human isolates are more resistant than food isolates [46]. Effectively, a study conducted in Qatar showed that 59% of healthy food handlers carried resistant E. coli in their hands and 27% were MDR [47]. The fact that healthy food handlers carry MDR E. coli represents an important public health risk to the general population because of the possibility of dissemination through contaminated food [47].

Independently of samples types, E. coli isolates show a resistance against the most tested antibiotics, and a total of 43 multiresistance profiles were determined. The profile showing resistance to “AMC, AMP, CN, SXT, NA, IPM, CAZ, CFM” was the most detected. The presence of this pattern can be explained by the large use of beta-lactams and cephalosporins as routine growth factors in veterinary and also as drugs of choice against E. coli in medicine [4850].

None of the studied isolates produced an ESBL, while a large number of worldwide studies reported their important rate isolation especially from food-producing animals as chicken, beef, pork, and milk [21, 22, 5153]. The ESBL absence is a positive point since the food is essentially destined to immune-depressed patients. Nevertheless, 27.7% of the E. coli isolates were carbapenemase-producing. Hence, the emergence of this isolates type in food or in the environment is worrying and an important concern for the public health sector specially that cephalosporins as “critically important” antimicrobials given that they represent the last treatment choice in human medicine for MDR bacterial infections [54, 55].

In conclusion, the present investigation is the first report on the prevalence and antibiotic resistance profiles of E. coli isolates obtained from food samples, food contact surfaces, and food handlers in hospital catering service in Morocco. The E. coli contamination was important with a high prevalence of MDR strains and the presence of E. coli non-O157/H7+. All E. coli isolates were resistant to at least 2 antibiotics (AMC and AMP). The obtained results highlight the need for continuous monitoring of the production chain and assessment of the implemented cleaning and sanitizing processes in order to minimize public-health risks. This study may draw the concerned authorities’ attention to control the transmission of multiresistant foodborne pathogens mainly in healthcare settings.

Data Availability

All the data used in this study are included within the article.

Conflicts of Interest

The authors declare that they have no conflicts of interest regarding the publication of this paper.

Acknowledgments

The authors would like to express their deep gratitude to the hospital kitchen staff for participating in this study.

References

  1. M. S. Donnenberg, Escherichia coli : Pathotypes and Principles of Pathogenesis, Elsevier/Academic Press, Cambridge, MA, USA, 2013.
  2. M. Aijuka and E. M. Buys, “Persistence of foodborne diarrheagenic Escherichia coli in the agricultural and food production environment: implications for food safety and public health,” Food Microbiology, vol. 82, pp. 363–370, 2019. View at: Publisher Site | Google Scholar
  3. K. Zerabruk, N. Retta, D. Muleta, and A. T. Tefera, “Assessment of microbiological safety and quality of minced meat and meat contact surfaces in selected butcher shops of Addis Ababa, Ethiopia,” Journal of Food Quality, vol. 2019, Article ID 3902690, 2019. View at: Publisher Site | Google Scholar
  4. M. R. Adams and Y. Motarjemi, Emerging Foodborne Pathogens, Woodhead Publishing, Cambridge, UK, 2006, https://www.sciencedirect.com/book/9781855739635/emerging-foodborne-pathogens.
  5. L. Beneduce, G. Spano, A. Q. Nabi et al., “Occurrence and characterization of Escherichia coli O157 and other serotypes in raw meat products in Morocco,” Journal of Food Protection, vol. 71, no. 10, pp. 2082–2086, 2008. View at: Publisher Site | Google Scholar
  6. M. Aijuka, A. E. Santiago, J. A. Girón, J. P. Nataro, and E. M. Buys, “Enteroaggregative Escherichia coli is the predominant diarrheagenic E. coli pathotype among irrigation water and food sources in South Africa,” International Journal of Food Microbiology, vol. 278, pp. 44–51, 2018. View at: Publisher Site | Google Scholar
  7. C.-Y. Chen, X. Yan, and C. R. Jackson, Antimicrobial Resistance and Food Safety : Methods and Techniques, Academic Press/ Elsevier, Cambridge, MA, USA, 1st edition, 2015.
  8. J. P. Horcajada, E. Shaw, B. Padilla et al., “Healthcare-associated, community-acquired and hospital-acquired bacteraemic urinary tract infections in hospitalized patients: a prospective multicentre cohort study in the era of antimicrobial resistance,” Clinical Microbiology and Infection, vol. 19, no. 10, pp. 962–968, 2013. View at: Publisher Site | Google Scholar
  9. R. Ranjbar, A. Seif, and F. S. Dehkordi, “Prevalence of antibiotic resistance and distribution of virulence factors in the shiga toxigenic Escherichia coli recovered from hospital food,” Jundishapur Journal of Microbiology, vol. 12, no. 5, 2019. View at: Publisher Site | Google Scholar
  10. R. Ranjbar, M. Masoudimanesh, F. S. Dehkordi, N. Jonaidi-Jafari, and E. Rahimi, “Shiga (Vero)-toxin producing Escherichia coli isolated from the hospital foods virulence factors, o-serogroups and antimicrobial resistance properties,” Antimicrobial Resistance & Infection Control, vol. 6, no. 1, 2017. View at: Publisher Site | Google Scholar
  11. B. M. Lund and P. R. Hunter, The Microbiological Safety of Food in Healthcare Settings, Blackwell Publishing Ltd., Hoboken, NJ, USA, 2008, http://www.scopus.com/inward/record.url?eid=2-s2.0-77953095870&partnerID=40&md5=74ff490cbca846a66ff0061a5096458e.
  12. F. J. Angulo and K. Molbak, “Human health consequences of antimicrobial drug--resistant Salmonella and other foodborne pathogens,” Clinical Infectious Diseases, vol. 41, no. 11, pp. 1613–1620, 2005. View at: Publisher Site | Google Scholar
  13. J. Docquier and S. Mangani, “An update on β -lactamase inhibitor discovery and development,” Drug Resistance Updates, vol. 36, Elsevier, 2018. View at: Publisher Site | Google Scholar
  14. G. Benjelloun Touimi, L. Bennani, S. Berrada, B. Moussa, and B. Bennani, “Prevalence and antibiotic resistance profiles of Staphylococcus sp. isolated from food, food contact surfaces and food handlers in a Moroccan hospital kitchen,” Letters in Applied Microbiology, vol. 70, no. 4, pp. 241–251, 2020. View at: Publisher Site | Google Scholar
  15. G. M. Evancho, W. H. Sveum, L. J. Moberg, and J. F. Frank, “Microbiological monitoring of the food processing environment,” in Compendium of Methods for The Microbiological Examination of Foods, American Public Health Association, 2nd edition, 2001. View at: Publisher Site | Google Scholar
  16. A. W. Paton and J. C. Paton, “Detection and characterization of shiga ToxigenicEscherichia coli by using multiplex PCR assays forstx 1, stx 2,eaeA, enterohemorrhagic E. coli hlyA,rfb O111, andrfb O157,” Journal of Clinical Microbiology, vol. 36, no. 2, pp. 598–602, 1998. View at: Publisher Site | Google Scholar
  17. V. P. Gannon, S. D'Souza, T. Graham, R. K. King, K. Rahn, and S. Read, “Use of the flagellar H7 gene as a target in multiplex PCR assays and improved specificity in identification of enterohemorrhagic Escherichia coli strains,” Journal of Clinical Microbiology, vol. 35, no. 3, pp. 656–662, 1997. View at: Publisher Site | Google Scholar
  18. EUCAST, “European committee on antimicrobial susceptibility testing,” Comité de l'Antibiogramme de la Société Française de Microbiologie, pp. 52–60, 2017. View at: Google Scholar
  19. L. Drieux, F. Brossier, W. Sougakoff, and V. Jarlier, “Phenotypic detection of extended-spectrum β-lactamase production in enterobacteriaceae: review and bench guide,” Clinical Microbiology and Infection, vol. 14, pp. 90–103, 2008. View at: Publisher Site | Google Scholar
  20. W. Song, S. G. Hong, D. Yong et al., “Combined use of the modified hodge test and carbapenemase inhibition test for detection of carbapenemase-producing enterobacteriaceae and metallo- β -Lactamase-producing Pseudomonas spp.,” Annals of Laboratory Medicine, vol. 35, no. 2, p. 212, 2015. View at: Publisher Site | Google Scholar
  21. V. Ntuli, P. M. K. Njage, and E. M. Buys, “Extended-spectrum β-lactamase, shigatoxin and haemolysis capacity of O157 and non-O157 E. coli serotypes from producer-distributor bulk milk,” International Dairy Journal, vol. 66, pp. 126–134, 2017. View at: Publisher Site | Google Scholar
  22. C. A. Kennedy, C. Walsh, M. Karczmarczyk et al., “Multi-drug resistant Escherichia coli in diarrhoeagenic foals: pulsotyping, phylotyping, serotyping, antibiotic resistance and virulence profiling,” Veterinary microbiology, vol. 223, pp. 144–152, 2018. View at: Publisher Site | Google Scholar
  23. S. H. Ryu, J. H. Lee, S. H. Park et al., “Antimicrobial resistance profiles among Escherichia coli strains isolated from commercial and cooked foods,” International Journal of Food Microbiology, vol. 159, pp. 263–266, 2012. View at: Publisher Site | Google Scholar
  24. A. Lalak, D. Wasyl, M. Zając et al., “Mechanisms of cephalosporin resistance in indicator Escherichia coli isolated from food animals,” Veterinary Microbiology, vol. 194, pp. 69–73, 2016. View at: Publisher Site | Google Scholar
  25. WHO, Enterohaemorrhagic Escherichia coli in Raw Beef And Beef Products: Approaches for the Provision of Scientific Advice, WHO, Geneva, Switzerland, 2011.
  26. A. Hiko, D. Asrat, and G. Zewde, “Occurrence of Escherichia coli O157: H7 in retail raw meat products in Ethiopia,” Journal of Infection in Developing Countries, vol. 2, pp. 389–393, 2008, http://www.embase.com/search/results?subaction=viewrecord&from=export&id=L355909064%5Cnhttp://sfx.hul.harvard.edu/sfx_local?sid=EMBASE&issn=19722680&id=doi:&atitle=Occurrence+of+Escherichia+coli+O157%3AH7+in+retail+raw+meat+products+in+Ethiopia.&stitle=J+. View at: Publisher Site | Google Scholar
  27. E. Gutiérrez-rodríguez, A. Gundersen, A. Sbodio, S. Koike, and T. V. Suslow, “Evaluation of post-contamination survival and persistence of applied attenuated E . coli O157 : H7 and naturally-contaminating E. coli O157 : H7 on spinach under field conditions and following postharvest handling,” Food microbiology, vol. 77, pp. 173–184, 2019. View at: Publisher Site | Google Scholar
  28. S. Pieniz, D. F. Rodrigues, R. M. Arndt et al., “Molecular identification and microbiological evaluation of isolates from equipments and food contact surfaces in a hospital food and nutrition unit,” Brazilian Journal of Biology, vol. 79, no. 2, pp. 191–200, 2019. View at: Publisher Site | Google Scholar
  29. J. M. Gonçalves, K. L. Rodrigues, F. Demoliner, R. Rossales, Â. T. S. Almeida, and M. R. D. Buchweitz, “Hygienic and sanitary conditions in the hospital foodservice: relationship between good practices and microbiological quality,” Journal of Food Safety, vol. 33, no. 4, pp. 418–422, 2013. View at: Publisher Site | Google Scholar
  30. G. Sharma, S. Sharma, P. Sharma et al., “Escherichia colibiofilm: development and therapeutic strategies,” Journal of Applied Microbiology, vol. 121, no. 2, pp. 309–319, 2016. View at: Publisher Site | Google Scholar
  31. G. B. Touimi, L. Bennani, S. Berrada, M. Benboubker, and B. Bennani, “Evaluation of hygienic conditions of food contact surfaces in a hospital kitchen in Morocco,” Iranian Journal of Microbiology, vol. 11, no. 6, pp. 527–534, 2019. View at: Google Scholar
  32. Z. Ma, E. W. Bumunang, K. Stanford, X. Bie, Y. D. Niu, and T. A. McAllister, “Biofilm formation by shiga toxin-producing Escherichia coli on stainless steel coupons as affected by temperature and incubation time,” Microorganisms, vol. 7, 2019. View at: Publisher Site | Google Scholar
  33. K. C. Klontz, B. Timbo, S. Fein, and A. Levy, “Prevalence of selected food consumption and preparation behaviors associated with increased risks of food-borne disease,” Journal of Food Protection, vol. 58, no. 8, pp. 927–930, 1995. View at: Publisher Site | Google Scholar
  34. H. Allam, M. Al-Batanony, A. Seif, and E. Awad, “Hand contamination among food handlers,” British Microbiology Research Journal, vol. 13, no. 5, pp. 1–8, 2016. View at: Publisher Site | Google Scholar
  35. S. L. Tan, H. Y. Lee, and N. A. Mahyudin, “Antimicrobial resistance of Escherichia coli and Staphylococcus aureus isolated from food handler's hands,” Food Control, vol. 44, pp. 203–207, 2014. View at: Publisher Site | Google Scholar
  36. A. A. Lambrechts, I. S. Human, J. H. Doughari, and J. F. R. Lues, “Bacterial contamination of the hands of food handlers as indicator of hand washing efficacy in some convenient food industries,” Pakistan J Med Sci, vol. 30, pp. 755–758, 2014. View at: Google Scholar
  37. E. C. D. Todd, J. D. Greig, C. A. Bartleson, and B. S. Michaels, “Outbreaks where food workers have been implicated in the spread of foodborne disease. Part 3. Factors contributing to outbreaks and description of outbreak categories,” Journal of Food Protection, vol. 70, no. 9, pp. 2199–2217, 2007. View at: Publisher Site | Google Scholar
  38. R. Garayoa, C. Abundancia, M. Díez-Leturia, and A. I. Vitas, “Essential tools for food safety surveillance in catering services: on-site inspections and control of high risk cross-contamination surfaces,” Food Control, vol. 75, pp. 48–54, 2017. View at: Publisher Site | Google Scholar
  39. H. Shojaei, J. Shooshtaripoor, and M. Amiri, “Efficacy of simple hand-washing in reduction of microbial hand contamination of Iranian food handlers,” Food Research International, vol. 39, no. 5, pp. 525–529, 2006. View at: Publisher Site | Google Scholar
  40. S. Badri, A. Fassouane, I. Filliol, M. Hassar, and N. Cohen, “Sequence analysis of the gene encoding H antigen in Escherichia coli isolated from food in Morocco,” The Journal of Microbiology, vol. 48, no. 2, pp. 184–187, 2010. View at: Publisher Site | Google Scholar
  41. F. Wang, Q. Yang, J. A. Kase et al., “Current trends in detecting non-O157 shiga toxin – producing Escherichia coli in food,” Foodborne Pathogens and Disease, vol. 10, pp. 1–11, 2013. View at: Publisher Site | Google Scholar
  42. B. Oporto, J. I. Esteban, G. Aduriz, R. A. Juste, and A. Hurtado, “Escherichia coli O157: H7 and non-O157 Shiga toxin-producing E. coli in healthy cattle, sheep and swine herds in Northern Spain,” Zoonoses and Public Health, vol. 55, no. 2, pp. 73–81, 2008. View at: Publisher Site | Google Scholar
  43. N. Rahmatallah, S. Nassik, H. E. L. Rhaffouli, I. L. Amine, and M. E. L. Houadfi, “Détection de souches multi-résistantes d ’ Escherichia coli d’origine aviaire dans la région de Rabat-Salé-Zemmour-Zaer,” Revue Marocaine des Sciences Agronomiques et Vétérinaires, vol. 1, pp. 96–102, 2016. View at: Google Scholar
  44. N. Rahmatallah, H. El Rhaffouli, I. L. Amine, O. F. Fihri, and M. El Houadfi, “Original article consumption of antibacterial molecules in broiler production in Morocco,” vol. 4, no. 2, pp. 80–90, 2018. View at: Google Scholar
  45. E. Skippington and M. A. Ragan, “Lateral genetic transfer and the construction of genetic exchange communities,” FEMS Microbiology Reviews, vol. 35, no. 5, pp. 707–735, 2011. View at: Publisher Site | Google Scholar
  46. M. J. Day, K. L. Hopkins, D. W. Wareham et al., “Extended-spectrum β-lactamase-producing Escherichia coli in human-derived and foodchain-derived samples from England, Wales, and Scotland: an epidemiological surveillance and typing study,” The Lancet Infectious Diseases, vol. 19, no. 12, pp. 1325–1335, 2019. View at: Publisher Site | Google Scholar
  47. N. O. Eltai, H. M. Yassine, A. A. Al Thani et al., “Prevalence of antibiotic resistant Escherichia coli isolates from fecal samples of food handlers in Qatar,” Antimicrobial Resistance & Infection Control, vol. 7, pp. 1–7, 2018. View at: Publisher Site | Google Scholar
  48. J. A. Hudson, L. J. Frewer, G. Jones, P. A. Brereton, M. J. Whittingham, and G. Stewart, “The agri-food chain and antimicrobial resistance: a review,” Trends in Food Science & Technology, vol. 69, pp. 131–147, 2017. View at: Publisher Site | Google Scholar
  49. S. Schwarz and E. Chaslus-Dancla, “Use of antimicrobials in veterinary medicine and mechanisms of resistance,” Veterinary Research, vol. 32, no. 3-4, pp. 201–225, 2001. View at: Publisher Site | Google Scholar
  50. K.-F. Kong, L. Schneper, and K. Mathee, “Beta-lactam antibiotics: from antibiosis to resistance and bacteriology,” Acta Pathol Microbiol Immunol Scand, vol. 118, pp. 1–36, 2011. View at: Publisher Site | Google Scholar
  51. S. P. Kuralayanapalya, S. S. Patil, S. Hamsapriya, R. Shinduja, P. Roy, and R. G. Amachawadi, “Prevalence of extended-spectrum beta-lactamase producing bacteria from animal origin: A systematic review and meta-analysis report from India,” PLoS One, vol. 14, pp. 1–15, 2019. View at: Publisher Site | Google Scholar
  52. A. Kaesbohrer, K. Bakran-lebl, A. Irrgang et al., “Diversity in prevalence and characteristics of ESBL/pAmpC producing E. coli in food in Germany,” Veterinary Microbiology, vol. 233, pp. 52–60, 2019. View at: Publisher Site | Google Scholar
  53. S. Sapkota, S. Adhikari, S. Khadka et al., “Multi-drug resistant extended-spectrum beta-lactamase producing E. coli and Salmonella on raw vegetable salads served at hotels and restaurants in Bharatpur, Nepal,” BMC Research Notes, vol. 12, pp. 1–6, 2019. View at: Publisher Site | Google Scholar
  54. World Health Organization & WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance (AGISAR)., “Critically important antimicrobials for human medicine: ranking of antimicrobial agents for risk management of antimicrobial resistance due to non-human use. 5th rev. World Health Organization,” 2017, https://apps.who.int/iris/handle/10665/255027. View at: Google Scholar
  55. A. Irrgang, B. A. Tenhagen, N. Pauly, S. Schmoger, A. Kaesbohrer, and J. A. Hammerl, “Characterization of VIM-1-producing E. coli isolated from a German fattening pig farm by an improved isolation procedure,” Frontiers in Microbiology, vol. 10, pp. 1–11, 2019. View at: Publisher Site | Google Scholar

Copyright © 2020 Benjelloun Touimi Ghita et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views524
Downloads347
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.