Research Article

Transcriptomic Response in Pseudomonas aeruginosa towards Treatment with a Kaempferol Isolated from Melastoma malabathricum Linn Leaves

Table 7

Transcript level comparison of P. aeruginosa genes between qRT-PCR and NGS. qRT-PCR is the mean of two biological replicates with three technical replicates for each gene. Reference gene (nadB): L-aspartate oxidase, uvrD, and sodM were downregulated at 24 h with no change at 6 h; fumC1 was upregulated at 6 h and downregulated at 24 h; rpsL was upregulated at 6 h with NC at 24 h exposure.

Genes IDGene symbolNGSqRT-PCRPrimersLength (bp)Description
Fold changeFold change
6 h24 h6 h24 h5′-sequence-3′

PA5443uvrDNC−3.412 ± 0NC−2.54 ± 0.01GTGCGCCTGTCCAATAC17DNA helicase II
GCCTTCGAAGTTGAGGATAG20
PA4468sodMNC−3.955 ± 0NC−2.44 ± 0.01GAGCAGCCGGTGGAAAGTCT20Superoxide dismutase
GCGACATCACGGTCCAGAAC20
PA4470fumC13.618 ± 0−4.599 ± 03.48 ± 0.69−5.39 ± 0TCGGGCAACTTCGAACTGAA20Fumarate hydratase
GAGCTTGCCCTGGTTGACCT20
PA4268rpsL2.56 ± 0NC3.53 ± 0.53NCCGGCACTGCGTAAGGTATGC2030S ribosomal protein S12
CCCGGAAGGTCCTTTACACG20
PA0761nadBReference geneCTACCTTTATACCAGCAATCCC22L-aspartate oxidase
CGGTGATGAGGAAACTCTTG20