Research Article
AmpC β-Lactamase Variable Expression in Common Multidrug-Resistant Nosocomial Bacterial Pathogens from a Tertiary Hospital in Cairo, Egypt
Table 1
PCR oligonucleotide primers used for the RT‐qPCR amplification of the AmpC gene extracted from the bacterial species of our study.
| Bacterial species | Primer name | Sequence (5′—3′) | PCR product | Reference |
| P. aeruginosa | PA. AmpC-F | CGCCGTACAACCGGTGAT | 113 bp | [18] | PA. AmpC-R | GAAGTAATGCGGTTCTCCTTTCA | K. pneumoniae | KP. AmpC-F | ATCTGGCAACCTATACCGCA | 227 bp | This study | KP. AmpC-R | CTTGAGCGGCTTAAAGACCC | E. faecium | EF. AmpC-F | GATCGACAGGATGTACGCGA | 300 bp | This study | EF. AmpC-R | CAGGTAACGCGGGTCTCTTT |
|
|