International Journal of Photoenergy / 2013 / Article / Tab 1

Research Article

Power Generation Enhancement by Utilizing Plant Photosynthate in Microbial Fuel Cell Coupled Constructed Wetland System

Table 1

Probe name and probe sequence used for FISH analysis.

ProbeTarget microfloraProbe sequenceReferences

EUB338Bacteria GCTGCCTCCCGTAGGAGT[21, 22]
GEO2Geobacter sulfurreducens GAAGACAGGAGGCCCGAAA[23]
HGEO2-1Helper probes for GEO2GTCCCCCCCTTTTCCCGCAAGA[23]
HGEO2-2Helper probes for GEO2CTAATGGTACGCGGACTCATCC[23]
BET42aBetaproteobacteria GCCTTCCCACTTCGTTT[24]

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.