International Scholarly Research Notices

International Scholarly Research Notices / 2012 / Article

Research Article | Open Access

Volume 2012 |Article ID 247631 | https://doi.org/10.5402/2012/247631

Jagdeep S. Deep, Sukhjeet Sidhu, Avinash Chandel, Shruti Thapliyal, Charu Garg, "Aberrant Methylation in Promoters of GSTP1, p16, p14, and RASSF1A Genes in Smokers of North India", International Scholarly Research Notices, vol. 2012, Article ID 247631, 6 pages, 2012. https://doi.org/10.5402/2012/247631

Aberrant Methylation in Promoters of GSTP1, p16, p14, and RASSF1A Genes in Smokers of North India

Academic Editor: A. Celi
Received07 Aug 2012
Accepted12 Sep 2012
Published18 Oct 2012

Abstract

Promoter hypermethylation plays an important role in the inactivation of tumor suppressor/metabolic genes during tumorigenesis. The screening of high-risk population (smokers) for hypermethylation pattern in tumor suppressor/metabolic genes can be a good noninvasive biomarker tool, which should be included in prognosis so that therapeutic measures can be initiated at an early stage. The purpose of this study was to determine the prevalence of aberrant promoter methylation of GSTP1, p16, p14, and RASSF1A genes in smokers and nonsmokers of North India. Our study showed that compared with nonsmokers, smokers have an increased risk of hypermethylation in these genes. We found that 57.3% of the smokers samples showed methylation for GSTP1, 38% for p16, 18% for p14, and 32% for RASSF1A. Our population study allowed us to reveal the relationship between smoking and the subsequent appearance of an epigenetic change. Smoking speeds up the hypermethylation of these genes, which are thus unable to express, making the person more susceptible to the risk of lung and other solid carcinomas. Hypermethylation studies on DNA from two lung cancer cell lines (A549 and H460) were also done to compare the results, and the results are similar to samples of smokers.

1. Introduction

Cancer is neither rare anywhere in the world, nor mainly confined to high-resource countries. The most commonly diagnosed cancers worldwide are lung followed by breast and colorectal cancers. Lung cancer is the most common cause of cancer-related mortality worldwide. About 1,80000 new cases are detected every year [1, 2]. Because of its high fatality (the ratio of mortality to incidence is 0.86) and the lack of variability in survival, in developed and developing countries, the highest and lowest mortality rates are estimated in the same regions, both in men and women. The large number of fatalities illustrates the lack of effective therapeutic alterations for a disease which is mostly diagnosed at an advanced stage [3]. There is a strong need for the development of biomarkers [46] that can spot this disease at an early stage which in turn would improve the survival rates. In comparison to mRNA, miRNA, and certain proteins, the use of genomic DNA methylation as biomarker has some novel attractions. Firstly, genomic DNA is highly stable, easy to extract, and secondly it can survive harsh conditions [7]. Genomic DNA has received special attention because of its potential application as a noninvasive, rapid, and sensitive tool which can lead to the development of clinically relevant biomarker for early detection of susceptibility to cancer, prediction of a likely treatment effect, and assessment of tumor response to therapy [8]. The role of methylation in altering gene expression is well established, and this has been detected in both tumor and circulating tumor DNA [9]. Aberrant promoter hypermethylation associated with an epigenetically mediated gene silencing constitutes an alternative to coding regions mutation for loss of gene function in cancer [10, 11]. The methyl-specific PCR (MSP) protocol designed by Herman et al. [12] is able to assay methylation status of CpG islands within a gene promoter that correlates with the loss of transcription.

Recently, several groups have reported that DNA hypermethylation is associated with exposure to tobacco smoke. The promoter methylation of several tumor suppressor genes have been reported in various tumors, including lung cancer, prostate cancer, and colorectal cancers. Among the common targets for aberrant methylation in lung/other solid tumors are the promoter regions of the GSTP1, p14, p16, and RASSF1 genes.

GSTP1, a metabolic gene, plays a key role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione [13]. GST is a group of phase II enzymes that have the ability to regulate the conjugation of carcinogenic compounds to excretable hydrophilic metabolites [14]. The glutathione S-transferase Pi gene (GSTP1) is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, particularly more in prostate cancer and other diseases [15].

p16 (p16INK4a/CDKN2A), a tumour suppressor gene, is a cell cycle regulator that is frequently inactivated in different types of malignancies, including lung cancer. The gene product of p16 protein is a molecular component of the retinoblastoma protein (pRB) regulatory pathway which inhibits G1 cyclin-dependent kinases [16, 17]. Inactivation of p16 enables phosphorylation of pRB that releases it from E2F transcription factor and allows progression of cells into S phase [18, 19]. Suppression of p16 expression has been reported in progression of lung cancer.

p14 gene (p14ARF/ARF) is an alternatively spliced variant of p16 gene encoding a distinct but important regulatory protein functioning in the p53 pathway [20]. Although encoded by the same locus, both proteins act in different cell cycle inhibition pathways. ARF product functions as a stabilizer of the tumor suppressor protein p53, as it can interact with, and sequester, MDM1, a protein responsible for the degradation of p53. This gene is known to be an important tumor suppressor gene. Methylation of p14 promoter has been shown to occur in various human tumours.

RASSF1A (Ras association domain family 1A) gene is a tumor suppressor gene. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1 and thus induce cell cycle arrest. Although the lack of expression of RASSF1A is common in lung cancer, mutations of RASSF1A are rare [21, 22]. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island rich promoter region. Suppression of RASSF1A expression has been reported in progression of lung cancer.

In this study, we want to investigate the prevalence of aberrant promoter methylation of GSTP1, p16, p14, and RASSF1A genes in smokers and nonsmokers of North India.

2. Materials and Methods

2.1. Sample Collection

One hundred and fifty blood samples of chronic smokers, with more than 5 cigarettes per day with history of 5 years or more of smoking habit, were collected from different regions of Northern India mainly Punjab, Haryana, Himachal Pradesh, and New Delhi. Of these smokers, of all males, 40% consumed alcohol too. As controls, blood was also collected from one hundred and fifty nonsmokers, chosen at random. The blood was collected in EDTA-coated vials and stored at −80°C until DNA was extracted.

2.2. Subject Enrolment

The study was approved by the Institute’s Ethics Committee, and all participants gave written informed consent. The subjects were selected randomly; most of them were students/faculty of engineering college and a large number of truck drivers who volunteered to be part of this study. The collection of samples was done by the paramedical staff. A detailed questionnaire designed by Indian Council of Medical Research (ICMR), containing all the information about the family history, age, smoking, drinking, and food habits was duly signed by the subjects at the time of collection of samples.

2.3. Cell Lines and Cell Culture

Human nonsmall cell lung cancer (NSCLC) cell lines H460 and A549 were obtained from NCCS, Pune. H460 cells were maintained in RPMI and A549 in Dulbecco’s Modified Eagle Medium (DMEM containing 25 mM glucose) and supplemented with 10% fetal bovine serum in a humidified incubator at 37°C with an atmosphere of 5% .

2.4. DNA Preparation

Genomic DNA was extracted from cell lines and peripheral blood leukocytes using proteinase-K digestion and phenol/chloroform purification followed by ethanol precipitation. All chemicals were brought from Sigma Aldrich Co.

2.5. From Blood Samples

Briefly, 500 μL of blood was taken in a 1.5 mL eppendorf tube and mixed with 1000 μL of RBC Lysis buffer (0.01 M Tris HCl, pH −7.6, 320 mM Sucrose, 5 mM MgCl2, and 1% Triton × 100). Tube was spun at 7000 rpm for 2 minutes. Supernatant was discarded, and steps were repeated three times to remove hemoglobin. Then 400 μL of Nucleic acid lysis buffer (0.01 M Tris HCl, 11.4 mM sodium citrate, 1 mM EDTA, 1% SDS) was added, followed by 100 μL of 5 M saturated NaCl and 600 μL of chloroform. Tubes were spun at 7000 rpm for 2 minutes, supernatant was transferred to fresh tube, and 800 μL of cold absolute ethanol was added to precipitate DNA. Tubes were mixed gently and then spun at 12000 rpm for 1 minute. Supernatant was discarded and tubes were dried at room temperature for 15 minutes. 30 μL of TE buffer, pH 8 was added and tubes were stored at −20°C until use.

2.6. From Cell Lines

DNA was extracted from cell lines using Sigma’s Gen Elute Mammalian Genomic DNA Miniprep Kit (G1N250) as per manufacturer’s details.

2.7. DNA Quantification

DNA was quantified using Nanodrop 2000 C (Thermo Fisher Co.) for both blood samples and cell lines.

2.8. Bisulfite Modification of Genomic DNA

DNA was modified by method described by Clark et al. [23]. Briefly, 2 μg of genomic DNA was denatured by adding 2 μL of 3 M NaOH. Samples were incubated at 37°C for 15 minutes and then at 90°C for 2.5 minutes. The tubes were immediately placed in ice so that DNA remains denatured. The tubes were centrifuged at 8000 rpm for 10 seconds to settle DNA. For each reaction, modification mixture was prepared by mixing: denatured DNA (2 μg), 208 μL, saturated sodium metabisulphite, pH-5, and 10 mM hydroquinone. Samples were properly mixed and incubated at 55°C in water bath for 16 hours.

The modified DNA was then desulfonated and purified using Sigma’s Imprint DNA Modification Kit (MOD50) using the prescribed protocol by the manufacturer. The modified DNA was then stored at −20°C until use.

2.9. Methylation-Specific PCR (MS-PCR)

MS-PCR was performed using primers specific for methylated and unmethylated DNA for GSTP1, p16, p14, and RASSF1A genes. Primers were designed using Methprimer, a program for designing bisulfite-conversion-based Methylation PCR Primers (http://www.urogene.org/methprimer/index1.html) [24] from the promoter regions of the four genes whose sequences were retrieved from Transcriptional Regulatory Element Database, TRED (http://rulai.cshl.edu/cgi-bin/TRED/tred.cgi?process=home) [25]. Details of the primers used in study are given in Table 1.


GeneAnnealing temperature (°C)Primer sequence (5′-3′)Amplicon size

p-14 MF55GTGTTAAAGGGCGGCGTAGC141
p-14 MR55TTTTTGGTGTTAAAGGGTGGTGTAGT
p-14 UF55AAAACCCTCACTCGCGACGA141
p-14 UR55CACAAAAACCCTCACTCACAACAA
p-16 MF56TTATTAGAGGGTGGGGCGGATCGC151
p-16 MR56TTATTAGAGGGTGGGGTGGATTGT
p-16 UF56CCACCTAAATCGACCTCCGACCG149
p-16 UR56CCACCTAAATCAACTCAACCTCCAACCA
RASSF1A MF53GTGTTAACGCGTTGCGTATC123
RASSF1A MR53TTTGGTTGGAGTGTGTTAATGTG
RASSF1A UF53AACCCCGCGAACTAAAAACGA123
RASSF1A UR53CAAACCCCACAAACTAAAAACAA
GSTP1 MF58TTCGGGGTGTAGCGGTCGT98
GSTP1 MR58GATGTTTGGGGTGTAGTGGTTGTT
GSTP1 MUF58GCCCCAATACTAAATCACGACG108
GSTP1 UR58CCACCCCAATACTAAATCACAACA

Universally methylated DNA (S7821, Chemicon) was used as a positive control for each gene. MS-PCR was performed using Sigma’s Jumpstart REDTaq ReadyMix PCR Reaction Mix (R2523). PCRs were carried out in Bio-Rad’s MJ Mini Thermal Cycler by using a hot start at 95°C for 5 min and the following cycling parameters: 38 cycles of 95°C for 30 s, X°C for 45 s, 72°C for 45 s, and 72°C for 10 min, and 4°C to cool. After PCR was done, the methylation and unmethylation-specific PCR products were run on 2% EtBr agarose gel at 60 V for 2 hours. The gel was then analyzed using Bio-Rad’s Gel Doc XR+ system.

2.10. Statistical Analysis

Statistical analysis was performed using Chi-square test or Fisher’s exact test for correlation between smoking and nonsmoking and drinking in combination with smoking in relation to hypermethylation status. All the tests were two sided, and was considered statistically significant.

3. Results

In the present study, the methylation pattern of GSTP1, p16, p14, and RASSF1A genes was studied in 300 samples, which included 150 smokers, 150 non smokers, and two NSCLC cell lines A549 and H460. Bisulfite conversion and MSP of universal methylated DNA (C. no. S7821, Chemicon) was used as a positive control and universal unmethylated DNA (C. no. S7822, Chemicon) as negative control (Figure 2). The drinking and food preference status of the subjects was also monitored, though the parameter for selection was smoking status only.

Amongst the smokers, 86 subjects out of total 150 showed hypermethylation (57.3%) in GSTP1, 57 of 150 (38%) in p16, 27 of 150 (18%) in p14, and 48 of 150 (32%) in case of RASSF1A. Even in nonsmokers, 23/150 (15.3%) in GSTP1, 18/150 (12%) in p16, 9/150 (6%) in p14, and 20/150 (13.3%) in RASSF1A showed hypermethylation (Figures 1 and 3). Amongst the non smokers, 4 subjects showed hypermethylation in GSTP1 gene, which on further investigation were found to be passive smokers who used to smoke earlier but left smoking 2-3 years ago. Out of the total 150 samples of smokers, 11 samples (7.3%) showed hypermethylation of all the four genes and out of these, 9 were drinkers also, but statistically no significant correlation was observed on this count. Our population study allowed us to reveal the relationship between smoking and the subsequent appearance of an epigenetic change. Smoking speeds up the hypermethylation of these genes, ( for GSTP1 and p16, Fisher’s exact test) and ( for p14, for RASSF1A) which are thus unable to express, making the person more susceptible to the risk of lung and other solid carcinomas.

Hypermethylation studies on DNA from two lung cancer cell lines (A549 and H460) were also done to compare the results, and the DNA from both these cell lines showed hypermethylation similar to what was observed in samples of smokers.

4. Discussion

The reason for the development of cancer in smokers can be epigenetic changes brought by the chemicals present in tobacco. Tobacco smoke contains numerous carcinogens, including 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, polyaromatic hydrocarbons, and metals such as chromium, cadmium, and nickel. These chemicals can lead to different epigenetic changes, most specifically changes in DNA methylation machinery. Tobacco smoke is also known to be a source of ROS generation in cells, and this ROS can lead to change in the activities of DNA methyltransferases and thus changes in methylation pattern of a number of genes. In this study, we investigated the association between smoking and the aberrant methylation of CpG islands at promoter regions of GSTP1, p14, p16, and RASSF1A genes that may play a role in the development of lung cancer and other solid carcinomas.

The results of this study indicate that aberrant promoter hypermethylation of these genes occurs frequently in smokers and passive smokers. These methylation changes persist even after smoking cessation. The results in comparison to controls (nonsmokers), positive control, and two NSCLC cell lines clearly indicate that smoking does change the methylation status of the promoter regions of GSTP1, p16, p14, and RASSF1A genes. Hypermethylation of these genes lead to transcriptional silencing, thus conferring increased risk of lung/other solid tumors. The promoter hypermethylation of these genes leads to epigenetic events that change and make the genetic environment of the transformed cell unstable [26]. Although cessation of smoking is associated with a decrease in lung cancer risk, but the prevalence of hypermethylation in these genes in passive smokers after a gap of 2-3 yrs does indicate that the hypermethylation changes once occurred persist for a longer period [27] and does make the subject vulnerable to the risk of lung/other solid tumors. The cumulative risk for lung cancer by age 75 for a person who quits smoking at age 50 is still six times greater than a never-smoker [28]. It is evident from the present study that smoking has a significant contribution towards hypermethylation of the promoter region of GSTP1, p16, p14, and RASSF1A genes ( , 0.0001, 0.0022, and 0.0002, resp., Fisher’s exact test) which increases the risk of developing cancers. This hypermethylation becomes more pronounced with age and drinking accompanied by smoking has a cascade effect in changing the methylation profile of these genes although it is not statistically significant. The study clearly demonstrates that cessation of smoking does not alter the methylation status much and passive smoking is also equally dangerous for changing the methylation status.

The study signifies the importance of continuous investigation of methylation profiling of smokers, where it can become a potential biomarker for the onset of lung cancer/other solid cancers, and an early intervention can save many precious lives. It has been shown that these biomarkers were present in sputum of cancer-free individuals with very high-risk for developing lung tumors [29]. However high frequency of promoter region hypermethylation was observed in p16, DAPK, and MGMT genes in oral cancer tissues as well as in corresponding adjacent normal mucosa [30]. Our previous studies [3134] have also established the use of aberrant gene methylation as a molecular biomarker system, as a potentially lifesaving approach. Moreover analyzing this from genomic DNA in blood promises a good noninvasive tool for population screening.

Conflict of Interests

The authors declared they have no conflict of interests.

References

  1. J. Ferlay, H. R. Shin, F. Bray, D. Forman, C. Mathers, and D. M. Parkin, “Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008,” International Journal of Cancer, vol. 127, no. 12, pp. 2893–2917, 2010. View at: Publisher Site | Google Scholar
  2. S. H. Landis, T. Murray, S. Bolden, and P. A. Wingo, “Cancer statistics, 1998,” Ca-A Cancer Journal for Clinicians, vol. 51, pp. 15–36, 2001, Erratum appears in Ca-A Cancer Journal for Clinicians, vol. 48, pp. 192, 1998. View at: Google Scholar
  3. G. M. Strauss, R. E. Gleason, and D. J. Sugarbaker, “Screening for lung cancer; another look: a different view,” Chest, vol. 113, no. 2, pp. 557–558, 1997. View at: Google Scholar
  4. D. Sidransky, “Emerging molecular markers of cancer,” Nature Reviews Cancer, vol. 2, no. 3, pp. 210–219, 2002. View at: Google Scholar
  5. P. W. Laird, “The power and the promise of DNA methylation markers,” Nature Reviews Cancer, vol. 3, no. 4, pp. 253–266, 2003. View at: Google Scholar
  6. S. A. Belinsky, K. J. Nikula, W. A. Palmisano et al., “Aberrant methylation of p16INK4a is an early event in lung cancer and a potential biomarker for early diagnosis,” Proceedings of the National Academy of Sciences of the United States of America, vol. 95, no. 20, pp. 11891–11896, 1998. View at: Google Scholar
  7. M. J. Duffy, R. Napieralski, J. W. M. Martens et al., “Methylated genes as new cancer biomarkers,” European Journal of Cancer, vol. 45, no. 3, pp. 335–346, 2009. View at: Publisher Site | Google Scholar
  8. R. E. Board, L. Knight, A. Greystoke et al., “DNA methylation in circulating tumor DNA as a biomarker for cancer,” Biomark Insights, vol. 2, pp. 307–319, 2007. View at: Google Scholar
  9. E. Gormally, E. Caboux, P. Vineis, and P. Hainaut, “Circulating free DNA in plasma or serum as biomarker of carcinogenesis: practical aspects and biological significance,” Mutation Research, vol. 635, no. 2-3, pp. 105–117, 2007. View at: Publisher Site | Google Scholar
  10. J. G. Herman and S. B. Baylin, “Gene silencing in cancer in association with promoter hypermethylation,” The New England Journal of Medicine, vol. 349, no. 21, pp. 2042–2054, 2003. View at: Publisher Site | Google Scholar
  11. S. B. Baylin, J. G. Herman, J. R. Graff, P. M. Vertino, and J. P. Issa, “Alterations in DNA methylation: a fundamental aspect of neoplasia,” Advances in Cancer Research, vol. 72, pp. 141–196, 1997. View at: Google Scholar
  12. J. G. Herman, J. R. Graff, S. Myöhänen, B. D. Nelkin, and S. B. Baylin, “Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands,” Proceedings of the National Academy of Sciences of the United States of America, vol. 93, no. 18, pp. 9821–9826, 1996. View at: Publisher Site | Google Scholar
  13. C. S. Morrow, K. H. Cowan, and M. E. Goldsmith, “Structure of the human genomic glutathione S-transferase-p1 gene,” Gene, vol. 75, no. 1, pp. 3–11, 1989. View at: Google Scholar
  14. T. R. Rebbeck, “Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility,” Cancer Epidemiology Biomarkers and Prevention, vol. 6, no. 9, pp. 733–743, 1997. View at: Google Scholar
  15. H. W. Lo, L. Stephenson, X. Cao, M. Milas, R. Pollock, and F. Ali-Osman, “Identification and functional characterization of the human Glutathione S-transferase P1 gene as a novel transcriptional target of the p53 tumor suppressor gene,” Molecular Cancer Research, vol. 6, no. 5, pp. 843–850, 2008. View at: Publisher Site | Google Scholar
  16. R. A. Kratzke, T. M. Greatens, J. B. Rubins et al., “Rb and p16INK4a expression in resected non-small cell lung tumors,” Cancer Research, vol. 56, no. 15, pp. 3415–3420, 1996. View at: Google Scholar
  17. H. Tanaka, Y. Fujii, H. Hirabayashi et al., “Disruption of the RB pathway and cell-proliferative activity in non-small-cell lung cancers,” International Journal of Cancer, vol. 79, no. 2, pp. 111–115, 1998. View at: Google Scholar
  18. M. Serrano, “The tumor suppressor protein p16INK4a,” Experimental Cell Research, vol. 237, no. 1, pp. 7–13, 1997. View at: Publisher Site | Google Scholar
  19. M. Ruas and G. Peters, “The p16INK4a/CDKN2A tumor suppressor and its relatives,” Biochimica et Biophysica Acta, vol. 1378, no. 2, pp. F115–F177, 1998. View at: Google Scholar
  20. N. E. Sharpless and R. A. Depinho, “The INK4A/ARF locus and its two gene products,” Current Opinion in Genetics and Development, vol. 9, no. 1, pp. 22–30, 1999. View at: Publisher Site | Google Scholar
  21. R. Dammann, C. Li, J. H. Yoon, P. L. Chin, S. Bates, and G. P. Pfeifer, “Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3,” Nature Genetics, vol. 25, no. 3, pp. 315–319, 2000. View at: Publisher Site | Google Scholar
  22. D. G. Burbee, E. Forgacs, S. Zöchbauer-Müller et al., “Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression,” Journal of the National Cancer Institute, vol. 93, no. 9, pp. 691–699, 2001. View at: Google Scholar
  23. S. J. Clark, A. Statham, C. Stirzaker, P. L. Molloy, and M. Frommer, “DNA methylation: bisulphite modification and analysis,” Nature Protocols, vol. 1, no. 5, pp. 2353–2364, 2006. View at: Publisher Site | Google Scholar
  24. L. C. Li and R. Dahiya, “MethPrimer: designing primers for methylation PCRs,” Bioinformatics, vol. 18, no. 11, pp. 1427–1431, 2002. View at: Google Scholar
  25. F. Zhao, Z. Xuan, L. Liu, and M. Q. Zhang, “TRED: a Transcriptional Regulatory Element Database and a platform for in silico gene regulation studies,” Nucleic Acids Research, vol. 33, pp. D103–D107, 2005. View at: Publisher Site | Google Scholar
  26. M. Esteller, “Epigenetic lesions causing genetic lesions in human cancer: promoter hypermethylation of DNA repair genes,” European Journal of Cancer, vol. 36, no. 18, pp. 2294–2300, 2000. View at: Publisher Site | Google Scholar
  27. S. Zöchbauer-Müller, S. Lam, S. Toyooka et al., “Aberrant methylation of multiple genes in the upper aerodigestive tract epithelium of heavy smokers,” International Journal of Cancer, vol. 107, no. 4, pp. 612–616, 2003. View at: Publisher Site | Google Scholar
  28. R. Peto, S. Darby, H. Deo, P. Silcocks, E. Whitley, and R. Doll, “Smoking, smoking cessation, and lung cancer in the UK since 1950: combination of national statistics with two case-control studies,” British Medical Journal, vol. 321, no. 7257, pp. 323–329, 2000. View at: Google Scholar
  29. W. A. Palmisano, K. K. Divine, G. Saccomanno et al., “Predicting lung cancer by detecting aberrant promoter methylation in sputum,” Cancer Research, vol. 60, no. 21, pp. 5954–5958, 2000. View at: Google Scholar
  30. V. Kulkarni and D. Saranath, “Concurrent hypermethylation of multiple regulatory genes in chewing tobacco associated oral squamous cell carcinomas and adjacent normal tissues,” Oral Oncology, vol. 40, no. 2, pp. 145–153, 2004. View at: Publisher Site | Google Scholar
  31. J. S. Deep and S. Sidhu, “Methylation pattern of E-cadherin gene as epigenetic biomarker in lung cancer patients,” Research Journal of Biotechnology, vol. 3, no. 4, pp. 32–34, 2008. View at: Google Scholar
  32. J. S. Deep and S. Sidhu, “Study of methylation pattern of APC gene as epigenetic biomarker in lung cancer patients,” Research Journal of Biotechnology, vol. 3, pp. 435–437, 2008. View at: Google Scholar
  33. J. S. Deep, “DNA methylation: epigenetics to molecular diagnostics,” Research Journal of BioTechnology, vol. 4, no. 4, pp. 3–4, 2009. View at: Google Scholar
  34. S. Sidhu, J. S. Deep, R. C. Sobti, V. L. Sharma, and H. Thakur, “Methylation pattern of MGMT gene in relation to age, smoking, drinking and dietary habits as epigenetic biomarker in prostate cancer patients,” Genetic Engineering and Biotechnology Journal. In press. View at: Google Scholar

Copyright © 2012 Jagdeep S. Deep et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views1725
Downloads650
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.