International Scholarly Research Notices / 2013 / Article / Tab 2

Research Article

Genotyping of CYP2D6 Polymorphisms by MALDI-TOF Mass Spectrometry in Sardinian People

Table 2

List of primers used in CYP2D6 long PCR protocols. The 5′ 10-mer tag was added to PCR primers, in order to improve PCR efficiency.

Nucleotides positionName5′ 10–mer tag5′-Sequence-3′Direction

From -1780 to -1758P-1780 [5]ACGTTGGATGGTCCTCCTGTCCTCAGTGGATForward
From -1584 to -1559P-1584_WT [5]ACGTTGGATGCAGCCTGGACAACTTGGAAGAAGCCForward
From -1584 to -1559P-1584_MUT [5]ACGTTGGATGCAGCCTGGACAACTTGGAAGAAGCGForward
From 4706 to 47282D6–R [19]ACGTTGGATGACTGAGCCCTGGGAGGTAGGTAReverse

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.