International Scholarly Research Notices

International Scholarly Research Notices / 2013 / Article

Research Article | Open Access

Volume 2013 |Article ID 609797 | https://doi.org/10.5402/2013/609797

Matteo Falzoi, Luigi Pira, Paolo Lazzari, Luca Pani, "Genotyping of CYP2D6 Polymorphisms by MALDI-TOF Mass Spectrometry in Sardinian People", International Scholarly Research Notices, vol. 2013, Article ID 609797, 10 pages, 2013. https://doi.org/10.5402/2013/609797

Genotyping of CYP2D6 Polymorphisms by MALDI-TOF Mass Spectrometry in Sardinian People

Academic Editor: A. Yamamoto
Received07 Mar 2013
Accepted04 Apr 2013
Published12 May 2013

Abstract

The CYP2D6 enzyme is involved in the metabolism of many commonly prescribed drugs. The presence of CYP2D6 gene SNPs can alter CYP2D6 enzymatic activity with effects ranging considerably within a population. Objectives. In this study, we have developed a genotyping platform able to determine the alleles related to interindividual variability in the CYP2D6 gene. Design and Methods. We used a long PCR strategy coupled to MALDI-TOF mass spectrometry (Sequenom) to develop a SNPs genotyping method. Furthermore, an amplification allele specific was carried out to infer the correct allelic phase. Results. We tested the multiplex platform in 250 DNA Sardinian samples and found it to be 100% concordant with the sequencing results of our previous work. Conclusions. The MALDI-TOF-based multiplexing system allowed simultaneous and efficient genotyping of a set of CYP2D6 SNPs, evidencing its potential use in diagnostic test development to predict drug responses and clinical outcomes.

1. Introduction

The presence of polymorphisms in the cytochrome P450 2D6 (CYP2D6) gene may modulate enzyme levels affecting individual responses to pharmacological treatment in drug level, response, and adverse reactions and includes individuals with ultrarapid (UM), extensive (EM), intermediate (IM), and poor (PM) metabolizer status. Furthermore, the presence of multiple functional gene copies or the deletion of the entire gene results in increased or absent drug metabolism, respectively [1, 2]. Genotypic analysis to identify individual polymorphisms has become increasingly important during drug development and for selection of individualized therapies. For this reason, high-throughput technology for rapid, accurate, and efficient genotyping is needed. Several strategies and methods for SNPs genotyping have been developed. Techniques commonly used, such as PCR-RFLP, real-time PCR, and the TaqMan allele-specific assays from Applied Biosystems (CA, USA), are often laborious, and a restricted number of alleles can be simultaneously detected by these techniques. Conversely, the high-throughput oligonucleotide microarray technology, such as the Affymetrix/Roche (CA, USA) AmpliChip CYP450 GeneChip test, has the disadvantage over other assays in that it cannot be customized by the user, and the benefits of this technology are often not compensable due to unfavourable costs [3]. In our previous work [4], we tried to create a complete genotyping platform for the simultaneous analysis of CYP3A4, CYP3A5, CYP2C9, CYP2C19, and CYP2D6 SNPs. The genotyping of the CYP2D6 gene was difficult due to its polymorphic nature, the presence of two flanking pseudogenes and copy number variants. To avoid false genotyping, resulting from nonspecific coamplification of the highly homologous pseudogenes, we developed the analysis of this gene in another way by using long PCR protocol coupled with single allele analysis and followed by sequencing [5]. In this work, we aimed to create a CYP2D6 medium-throughput SNPs screening platform using the Sequenom (CA, USA) matrix-assisted laser desorption/ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS) [6], a widely used technology that is proving to be a competitive analysis method in SNPs genotyping. Advantages of MALDI-TOF MS over previously described methods include the option for medium-high-throughput automated analysis of SNPs, the relative ease of setup for multiplex assays, and the reduced costs per genotype [3].

2. Methods and Materials

SNPs and Sequences Selection. The 69 polymorphisms analyzed in this study were selected using principal SNP web databases such as the Human CYP Allele Nomenclature Committee [7] and the NCBI Single Nucleotide Polymorphism dbSNP [8] websites. Selection criteria depended mainly on the pharmacogenetic effects described for every allele in the Caucasian population [5, 7, 916]. Not all selected SNPs are involved in aminoacidic or transcriptional variation (Table 1). Some of these are silent or promoter, leader, trailer, and intronic changes and inserted in our study because they are essential for the reconstruction of haplotype phases. The SNPs’ recombination allowed the reconstruction of 66 among allelic variants and subvariants. List of alleles is summarized in Table 5.


CYP2D6 SNPsVariations

-1584C>G
-1426C>T
-1235A>G
-1000G>A
-948C>A
-750_-749delGA
-740C>T
-678G>A
19G>AV7M
31G>AV11M
77G>AR26H
82C>T
100C>TP34S
124G>AG42R
137_138insTFrameshift
214G>C (*)
310G>T
746C>G
843T>G
883G>CSplicing defect
957C>TA85V
974C>AL91M
984A>GH94R
997C>G
1039C>T
1513C>T
1659G>AV136I
1661G>C
1704C>GQ151E
1707delTFrameshift
1724C>T
1749A>GN166D
1757C>T
1758G>AG169R
1758G>TG169X
1846G>ASplicing defect
1863_1864insTTTCGCCCC174_175insFRP
1869T>C
1943G>AR201H
1979T>C
2291G>A
2483G>TA237S
2539_2542delAACTFrameshift
2549delAFrameshift
2575C>A
2587_2590delGACTFrameshift
2615_2617delAAGK281del
2850C>TR296C
2853A>CI297L
2935A>CH324P
2939G>A
2988G>ASplicing defect
3176C>T
3183G>AV338M
3198C>GR343G
3277T>CI369T
3288G>A
3384A>C
3582A>G
3584G>A
3790C>T
3828G>A
3853G>AE410K
3877G>AE418K
3948T>G
4115C>T
4155C>T (°)H478Y
4180G>CS486T
4401C>T
4481G>A

In MALDI-TOF MS analysis, (*) 214G>C SNP was used to discriminate gene conversion to CYP2D7P in Intron 1, and (°) 4155C>T SNP was used to discriminate gene conversion to CYP2D7P in Exon 9. A = alanine; R = arginine; N = asparagine; D = aspartic acid; C = cysteine; E = glutamic acide; Q = glutamine; G = glycine; H = histidine; I = isoleucine; L = leucine; K = lysine; M = methionine; F = phenylalanine; P = proline; S = serine; T = threonine; W = tryptophan; Y = tyrosine; V = valine. In bold characters newly discovered SNPs in [5, 17, 18, 21].

DNA Samples. In this study, we reanalyzed the genomic DNAs studied in [5]. Sardinian DNA samples were gently furnished by Professor Francesco Cucca, INN-CNR Cagliari Director. All participating individuals provided informed consent to genetic test. To genotype these samples, we implemented a CYP2D6 Genotyping Platform based on MALDI-TOF MS. This way, we would be able to compare our genotyping results with a previous sequencing analysis in [5].

2.1. CYP2D6 Genotyping Platform
2.1.1. Long Primary PCR

Selective amplification of the CYP2D6 gene was carried out modifying a long PCR protocol implemented in our previous work [5]. Forward primer (P-1780, Table 2) was designed in a highly nonhomologous CYP2D6/CYP2D7P/CYP2D8P 5′ untranslated region [5]. The reverse primer used was 2D6-R (Table 2), as previously described [19]. A 5′ 10-mer tag (5′-ACGTTGGATG-3′) was added to both PCR primers in order to improve PCR efficiency. PCR reactions were performed in a final volume of 5 μL using the QIAGEN (Hilden, Germany) LongRange PCR Kit protocol [20] with the following minor modifications: 20 ng genomic DNA, 400 μM of each PCR primer (Metabion, Martinsried, Germany), 0.2 U QIAGEN LongRange PCR enzyme, 1X QIAGEN LongRange PCR buffer (containing MgCl2 25 mM), and 500 μM Invitrogen (CA, USA) 2′-deoxynucleoside-5′-triphosphate (dNTP) Set PCR Grade. The PCR conditions were as follows: initial denaturation at 93°C for 3 min; 35 cycles at 93°C for 30 s, 61°C for 30 s, and 68°C for 6 min.


Nucleotides positionName5′ 10–mer tag5′-Sequence-3′Direction

From -1780 to -1758P-1780 [5]ACGTTGGATGGTCCTCCTGTCCTCAGTGGATForward
From -1584 to -1559P-1584_WT [5]ACGTTGGATGCAGCCTGGACAACTTGGAAGAAGCCForward
From -1584 to -1559P-1584_MUT [5]ACGTTGGATGCAGCCTGGACAACTTGGAAGAAGCGForward
From 4706 to 47282D6–R [19]ACGTTGGATGACTGAGCCCTGGGAGGTAGGTAReverse

2.1.2. SAP Dephosphorylation

To neutralize unincorporated dNTPs after amplification reactions, 0.3 U of Shrimp Alkaline Phosphatase (SAP) (Sequenom) [26, 27] was used. SAP cleaved a phosphate from the unincorporated dNTPs, converting them to 2′-deoxynucleoside-5′-diphosphate (dNDP) and rendering them unavailable for following reactions. Dephosphorylation conditions were as follows: 37°C for 20 min and 85°C for 5 min.

2.1.3. Assay Design

SNP-specific unextended minisequencing primers (UEPs) and multiplexed UEPs assays were designed using both the Sequenom MassARRAY assay design version 3.1 and the RealSNP assay database [28]. A sequence of 400 base pairs (bp) flanking each selected SNP was downloaded from the corresponding genomic sequence stored in the public NCBI Single Nucleotide Polymorphism dbSNP database [8] or the Ensembl Genome Browser [29] and was analyzed by Vector NTI Suite Software version 5.5 (InforMax, Oxford, UK). Combination of the UEPs into multiplex assays was supported by these software applications to allow the optimization of several different parameters, for example, to avoid the risk of primer-primer interactions and hairpin-loop formations, GC content, molecular mass range, and annealing temperatures. To achieve the highest possible multiplexing levels, we tested many primer combinations, leading us to the final assay design consisting in a total of 69 SNPs successfully assembled in five medium-plex assays (13-, 14-, 13-, 14-, and 15-plex) (Table 3). For some SNPs, Sequenom MassARRAY assay design and RealSNP assay database could not design SNP-specific UEPs because of the presence of proximal SNPs. Other SNPs were excluded during platform validation because of UEPs cross-hybridization in highly homologous PCR template regions or for the presence of primer dimers which created false allele. But the high number of SNPs inserted in our analysis has allowed us to infer the correct alleles for each DNA analysis. List of SNPs not included is summarized in Table 4.


UEPs’ sequencesUDUMEP lower mass sequencesELMELCEP higher mass sequencesEHMEHC

(1) 13-PLEX
3877G>ACCTTCCGCTTCCACCCCF CCTTCCGCTTCCACCCCA ACCTTCCGCTTCCACCCCG G
3183G>ACCGCACCTGCCCTATCAR CCGCACCTGCCCTATCAC GCCGCACCTGCCCTATCAT A
2615_2617 delAAGGGCAGCCACTCTCACCTR GGCAGCCACTCTCACCTC delGGCAGCCACTCTCACCTT AGA
2483G>TGCGTAGGACCTTGCCAGR GCGTAGGACCTTGCCAGC GGCGTAGGACCTTGCCAGA T
3853G>AGAAGCGGAAGGGCTTCTR GAAGCGGAAGGGCTTCTC GGAAGCGGAAGGGCTTCTT A
3277T>CTGCAGCGCTTTGGGGACAF TGCAGCGCTTTGGGGACAC CTGCAGCGCTTTGGGGACAT T
4180G>CAGCTCATAGGGGGATGGGR AGCTCATAGGGGGATGGGC GAGCTCATAGGGGGATGGGG C
2939G>ATGGGCTCACGCTGCACATCR TGGGCTCACGCTGCACATCC GTGGGCTCACGCTGCACATCT A
3288G>AGATGTCATATGGGTCACACR GATGTCATATGGGTCACACC GGATGTCATATGGGTCACACT A
3176C>TGGCCGTGTCCAACAGGAGATF GGCCGTGTCCAACAGGAGATC CGGCCGTGTCCAACAGGAGATT T
2850C>TAGCTTCAATGATGAGAACCTGF AGCTTCAATGATGAGAACCTGC CAGCTTCAATGATGAGAACCTGT T
2935A>CAGTGCTCACGCTGCACATCCGGAR AGTGCTCACGCTGCACATCCGGAG CAGTGCTCACGCTGCACATCCGGAT A
1757C>TTTGTGCCGCCTTCGCCAACCACTCF TTGTGCCGCCTTCGCCAACCACTCC CTTGTGCCGCCTTCGCCAACCACTCT T

(2) 14-PLEX
1661G>CCAGAGGCGCTTCTCCGTF CAGAGGCGCTTCTCCGTC CCAGAGGCGCTTCTCCGTG G
1869T>CACGGCTTTGTCCAAGAGR ACGGCTTTGTCCAAGAGA TACGGCTTTGTCCAAGAGG C
1846G>AGGGGCGAAAGGGGCGTCR GGGGCGAAAGGGGCGTCC GGGGGCGAAAGGGGCGTCT A
214G>CTGGAGGGCGGCAGAGGTF TGGAGGGCGGCAGAGGTC CTGGAGGGCGGCAGAGGTG G
19G>ACTGGGGCTAGAAGCACTGF CTGGGGCTAGAAGCACTGA ACTGGGGCTAGAAGCACTGG G
1707delTGCGGCCTCCTCGGTCACCCR GCGGCCTCCTCGGTCACCCC delGCGGCCTCCTCGGTCACCCA T
746C>GGCGACCCAGCCTCCTGATCR GCGACCCAGCCTCCTGATCC GGCGACCCAGCCTCCTGATCG C
997C>GGAACAGGCGGGCGGTCGGCR GAACAGGCGGGCGGTCGGCC GGAACAGGCGGGCGGTCGGCG C
100C>TAATGCTGGGCTGCACGCTACF AATGCTGGGCTGCACGCTACC CAATGCTGGGCTGCACGCTACT T
1979T>CGGACAGCCCGACTCCTCCTTCR GGACAGCCCGACTCCTCCTTCA TGGACAGCCCGACTCCTCCTTCG C
-948C>ACAGGCTGGGGCAAGGGCCTTCF CAGGCTGGGGCAAGGGCCTTCC CCAGGCTGGGGCAAGGGCCTTCA A
1749A>GGCCCATCACCCACCGGAGTGGTR GCCCATCACCCACCGGAGTGGTC GGCCCATCACCCACCGGAGTGGTT A
77G>AGTAGCGTGCAGCCCAGCGTTGGR GTAGCGTGCAGCCCAGCGTTGGC GGTAGCGTGCAGCCCAGCGTTGGT A
1513C>TAGCTGGACAGAGCCAGGGACTGF AGCTGGACAGAGCCAGGGACTGC CAGCTGGACAGAGCCAGGGACTGT T

(3) 13-PLEX
984A>GGCGAGTGTCCTCGCCGR GCGAGTGTCCTCGCCGC GGCGAGTGTCCTCGCCGT A
1863_1864ins TTTCGCCCCGACGCCCCTTTCGCCCCF GACGCCCCTTTCGCCCCA GACGCCCCTTTCGCCCCT TTTCGCCCC
1039C>TACCCAGATCCTGGGTTTF ACCCAGATCCTGGGTTTC CACCCAGATCCTGGGTTTT T
1943G>ACCAGCAGCCTGAGGAAGR CCAGCAGCCTGAGGAAGC GCCAGCAGCCTGAGGAAGT A
974C>ACGGCCGTGCGCGAGGCGF CGGCCGTGCGCGAGGCGC CCGGCCGTGCGCGAGGCGA A
1704C>GGGCAAGAAGTCGCTGGAGF GGCAAGAAGTCGCTGGAGC CGGCAAGAAGTCGCTGGAGG G
310G>TTAAATGCCCTTCTCCAGGAR TAAATGCCCTTCTCCAGGAC GTAAATGCCCTTCTCCAGGAA T
957C>TGTCGTGCTCAATGGGCTGGF GTCGTGCTCAATGGGCTGGC CGTCGTGCTCAATGGGCTGGT T
883G>CTCCCCGAAGCGGCGCCGCAAR TCCCCGAAGCGGCGCCGCAAC GTCCCCGAAGCGGCGCCGCAAG C
1659G>ACGCGAGCAGAGGCGCTTCTCCF CGCGAGCAGAGGCGCTTCTCCA ACGCGAGCAGAGGCGCTTCTCCG G
31G>AAGCAGGAAGATGGCCACTATCAR AGCAGGAAGATGGCCACTATCAC GAGCAGGAAGATGGCCACTATCAT A
1724C>TGCGAAGGCGGCACAAAGGCAGGCR GCGAAGGCGGCACAAAGGCAGGCA TGCGAAGGCGGCACAAAGGCAGGCG C
124G>ATCACATGCAGCAGGTTGCCCAGCCR TCACATGCAGCAGGTTGCCCAGCCC GTCACATGCAGCAGGTTGCCCAGCCT A

(4) 14-PLEX
3198C>GACCCATCTCTGGTCGCCR ACCCATCTCTGGTCGCCC GACCCATCTCTGGTCGCCG C
2549delATGGGTCCCAGGTCATCCR TGGGTCCCAGGTCATCCG delTGGGTCCCAGGTCATCCT A
3582A>GGAATGTTGGAGGACCCAF GAATGTTGGAGGACCCAA AGAATGTTGGAGGACCCAG G
2539_2542 delAACTACAGCTGGATGAGCTGCTF ACAGCTGGATGAGCTGCTA AACTACAGCTGGATGAGCTGCTG del
3790C>TCCACTCTCACCCTGCATCTF CCACTCTCACCCTGCATCTC CCCACTCTCACCCTGCATCTT T
4115C>TACCTCCCTGCTGCAGCACTTF ACCTCCCTGCTGCAGCACTTC CACCTCCCTGCTGCAGCACTTT T
4481G>AGAATCTGACTGCCCAGATTGF GAATCTGACTGCCCAGATTGA AGAATCTGACTGCCCAGATTGG G
3828G>AACTCATCACCAACCTGTCATCF ACTCATCACCAACCTGTCATCA AACTCATCACCAACCTGTCATCG G
3384A>CCATGCTGGGGCTATCACCAGGR CATGCTGGGGCTATCACCAGGG CCATGCTGGGGCTATCACCAGGT A
2853A>CGAGAACAGGTCAGCCACCACTAR GAGAACAGGTCAGCCACCACTAG CGAGAACAGGTCAGCCACCACTAT A
2988G>ACATGTGCCCCCGCCTGTACCCTTR CATGTGCCCCCGCCTGTACCCTTC GCATGTGCCCCCGCCTGTACCCTTT A
3584G>AGTCAGAATGTTGGAGGACCCAACF GTCAGAATGTTGGAGGACCCAACA AGTCAGAATGTTGGAGGACCCAACG G
4401C>TTAACTGACATCTGCTCAGCCTCAACR TAACTGACATCTGCTCAGCCTCAACA TTAACTGACATCTGCTCAGCCTCAACG C
2587_2590 delGACTATCAGCTCAGCCCCCCCGAGACCTGAF ATCAGCTCAGCCCCCCCGAGACCTGAC GACTATCAGCTCAGCCCCCCCGAGACCTGAG del

(5) 15-PLEX
3948T>GTCTCAGCAGGTGCCTGF TCTCAGCAGGTGCCTGG GTCTCAGCAGGTGCCTT T
-1235A>GGCACCACCCAGCCTAATR GCACCACCCAGCCTAATC GGCACCACCCAGCCTAATT A
137_138insTGAAGTCCACATGCAGCAR GAAGTCCACATGCAGCAA TGAAGTCCACATGCAGCAG
4155C>TCAGCCCCGGCCCAGCCACF CAGCCCCGGCCCAGCCACC CCAGCCCCGGCCCAGCCACT T
82C>TGTGTAGCGTGCAGCCCAGCR GTGTAGCGTGCAGCCCAGCA TGTGTAGCGTGCAGCCCAGCG C
-1584C>GCTGGACAACTTGGAAGAACCF CTGGACAACTTGGAAGAACCC CCTGGACAACTTGGAAGAACCG G
2575C>AGACCTGGGACCCAGCCCAGCCF GACCTGGGACCCAGCCCAGCCC CGACCTGGGACCCAGCCCAGCCA A
843T>GACTAGGACCTGTAGTCTGGGGF ACTAGGACCTGTAGTCTGGGGG GACTAGGACCTGTAGTCTGGGGT T
-740C>TACAGACTCACACTGACACTTAGR ACAGACTCACACTGACACTTAGA TACAGACTCACACTGACACTTAGG C
-678G>ACTTTGTGTGGGTGATTTTCTGCF CTTTGTGTGGGTGATTTTCTGCA ACTTTGTGTGGGTGATTTTCTGCG G
-750_-749 delGATGTGACTGGTGTGTGTGAGAGAF TGTGACTGGTGTGTGTGAGAGAA delTGTGACTGGTGTGTGTGAGAGAG GA
2291G>ACACTCGCCAAGTGCCAGCCTCCACR CACTCGCCAAGTGCCAGCCTCCACC GCACTCGCCAAGTGCCAGCCTCCACT A
-1426C>TGTGTGCCACCACGTCTAGCTTTTTR GTGTGCCACCACGTCTAGCTTTTTA TGTGTGCCACCACGTCTAGCTTTTTG C
1758G>T>ATTGTGCCGCCTTCGCCAACCACTCCF TTGTGCCGCCTTCGCCAACCACTCCA ATTGTGCCGCCTTCGCCAACCACTCCG G
TTGTGCCGCCTTCGCCAACCACTCCT T
-1000G>AACATCCTCCCGGGCTGCCTGAGGGTR ACATCCTCCCGGGCTGCCTGAGGGTC GACATCCTCCCGGGCTGCCTGAGGGTT A

UD: Unextended mini–sequencing primer Direction; F: Forward UEP direction; R: Reverse UEP direction; UM: Unextended mini–sequencing primers Mass; ELM: Extended primer Lower Mass; EHM: Extended primer Higher Mass; ELC: Extended primer lower Mass nucleotide Called; EHC: Extended primer higher Mass nucleotide Called; All molecular weight masses are expressed in Dalton (Da).

SNPs excludedVariationsReason

-1770G>A Cross-hybridization
-1298G>A Primer dimers
-1253A>G Primer dimers
-1237_-1236insAA Proximal SNP -1235A>G Primer dimers
1973_1974insGFrameshiftProximal SNP 1979T>C
1976G>A Proximal SNP 1979T>C
1978C>T Proximal SNP 1979T>C
2097A>G Primer dimers
2470T>C Cross hybridization
4042G>A Primer dimers


Variant alleleNumber of chromosomesFrequency (%)Correlated enzymatic activity

 *1A EM
* 1B EM
* 1D EM
* 1E EM
* 2A EM
* 2B EM
* 2D EM
* 2E EM
* 2F EM
* 2G EM
* 2K EM
* 2L EM
* 2M EM
SH3 Not known
SH4 Not known
* 3A PM
* 3B PM
* 4A PM
* 4B PM
* 4D PM
* 4K PM
* 4L PM
* 4M PM
* 4N PM
* 5 PM
* 6A PM
* 6C PM
* 6D PM
* 7 PM
* 8 PM
* 9 IM
* 10A IM
* 10B IM
* 11 PM
* 12 PM
* 14A PM
* 14B IM
* 15 PM
* 17 IM
* 19 PM
* 20 PM
* 22 Not known
* 23 Not known
* 24 Not known
* 25 Not known
* 26 Not known
* 27 EM
* 28 Not known
* 29 IM
* 30 Not known
* 31 PM
* 32 Not known
* 33 EM
* 35A EM
* 36 IM
* 37 Not known
* 38 PM
* 39 EM
* 41 IM
SH1 Not known
SH2 Not known
* 43 Not known
* 58 Not known
* 59 IM
* 64 Not known
* 65 Not known
* 1xN UM
* 2xN UM

SH1,2,3,4 = Sardinian haplotype 1,2,3,4 [5, 2225]. CYP2D6*5,*1xN; and *2xN alleles were evaluated by The CYP2D6 Applied Biosystems CNV Assay in [5].
2.1.4. iPLEX Reactions

iPLEX reactions were carried out following the Sequenom standard low/medium-plex protocol [6, 26, 27], with minor modifications. Because of the length of the primary PCR fragment and the high GC content, we increased the denaturation time at 94°C from 5 to 30 sec and the annealing temperature from 52 to 56°C. An iPLEX reaction cocktail was added to the amplification products and thermocycled to process the iPLEX reaction, which involved the enzymatic addition of one of the four mass-modified nucleotides, 2′,3′-dideoxynucleoside-5′-triphosphate (ddNTP), into the polymorphic site. During the iPLEX reaction, each primer was extended by one of the ddNTPs which terminated the extension of primers, thus producing allele-specific extension products of different masses. The iPLEX reaction cocktail included 0.222X iPLEX buffer plus, 0.5X iPLEX termination mix, 0.5X iPLEX enzyme, and UEPs, which were divided into four mass groups, according to the position of their respective mass peaks to use the whole spectrum (final concentrations of 0.8–2.0 μM). In the iPLEX termination mix, all four ddNTPs are present at the same concentration. The reactions were performed using a two cycling loop program: initial denaturation at 94°C for 30 s; followed by 40 cycles of 94°C for 30 s, 56°C for 5 s, and 80°C for 5 s. This annealing and extension procedure was repeated four times (to give a total of 200 short cycles), followed by a final extension step of 3 min at 72°C. After desalting by addition of 6 mg clean resin (Sequenom), each 384-well sample was diluted with 16 μL of sterilized .

Multiplex PCR reactions, SAP dephosphorylation, and iPLEX reactions were performed using Thermo-Fast 384 PCR Plates (ABgene, Epsom, UK) and a DNA Engine Tetrad 2 Peltier Thermal Cycler (Bio-Rad, CA, USA). All pipetting steps were performed using the automatic station Matrix PlateMate 2 × 2 (Sequenom).

2.1.5. MALDI-TOF MS Measurement

An aliquot ranging from 15 to 20 nL of each iPLEX reaction product was loaded in a 384-spot SpectroChip (Sequenom) using the MassArray Nanodispenser (Samsung, Seoul, Repubic of Korea). SpectroChip analysis was performed by MassARRAY Compact System (Sequenom). After laser desorption/ionization, automated spectra acquisition analysis was performed and interpreted using Sequenom MassARRAY RT version 3.3 software. Examples of multiplex mass spectrum and cluster plot distributions are shown in Figures 1 and 2.

2.2. CYP2D6 Single Allele Genotyping

Following direction of our previous work [5], we decided to apply the single allele protocol creating a single allele genotyping method MALDI-TOF MS based. For each sample, a double long PCR reaction was carried out using P-1584_WT or P-1584_MUT [5] (Table 2) as forward primers. The reverse primer was 2D6-R [19] for both PCR reactions. In this way, we were able to directly determine a direct and correct chromosome phase in samples presenting with a heterozygous status for −1584G>C SNP. PCR reactions were performed in a final volume of 5 μL using 20 ng genomic DNA, 400 μM of each PCR primer (Metabion), 0.2 U QIAGEN LongRange PCR enzyme, 1X QIAGEN LongRange PCR buffer (containing MgCl2 25 mM), and 800 μM Invitrogen dNTP set PCR grade. The PCR conditions were as follows: initial denaturation at 93°C for 3 min; 10 cycles at 93°C for 30 s, 67°C for 30 s, and 68°C for 3 min; 25 cycles at 93°C for 30 s, 65°C for 30 s, and 68°C for 6 min. SAP dephosphorylation, iPLEX Reactions and MALDI-TOF MS measurement were performed without modifications as indicated in paragraph 1 “CYP2D6 Genotyping Platform”. In multiplexed assay 5, −1584G>C UEP (Table 3) was excluded. Examples of cluster distribution for novel 3176C>T and 3948T>G SNPs [5, 17, 18] are shown in Figure 3.

3. Results and Discussion

A CYP2D6 screening assay was developed using the Sequenom MassARRAY platform to simultaneously identify the most frequent and some rare CYP2D6 Caucasian alleles. We have modified the basic Sequenom iPLEX assay and used a new primary PCR strategy based on the amplification of the entire gene [5] coupled with multiplex primer extension reactions. This strategy avoids false genotyping, which would result in nonspecific coamplification of the homologous pseudogenes CYP2D7P and CYP2D8P, and, secondly, it reduces the number of PCR primers used to select regions containing the targeted polymorphisms. Multiplexing was performed for 69 SNPs, which represents 66 of the most frequent and some rarer variants and subvariants reported to date in the Caucasian population [5, 7, 916] and known to be responsible for absent, reduced or extensive metabolic activity (Tables 1 and 5). Due to the high possibility of recombination, it was possible to insert African, African-American ( , , , , and ) and Asian ( , , , , , and ) variants in the study. A sample of 250 unrelated healthy Sardinian individuals analyzed in [5] was submitted to MALDI-TOF MS genotyping for these 69 CYP2D6 SNPs. An example of multiplex mass spectrum is shown in Figure 1. In Figure 2(a), an example of the cluster plot distribution for the 1661G>C SNP is shown. Spectrum peak intensities were not correctly balanced in some heterozygous samples (Figures 2(c) and 2(d)), which appeared as outliers in the cluster distribution (Figure 2(a) point and ). The CYP2D6 Applied Biosystems Copy Number Variation (CNV) Assay used to analyze these DNAs in our previous work [5] detected the presence of duplications or multiplications in 100% of the analyzed samples presenting this kind of distribution. Furthermore, in samples presenting a heterozygous status for −1584G>C SNP, we applied long PCR single allele analysis [5] to MALDI-TOF MS screening assays and inferred a direct haplotype phase. To verify if our CYP2D6 platform works correctly, we compared genotyping results and haplotype phase elaborated in the two screening platforms with our results found in [5]. A consensus of 100% was found for all samples (Table 5). Moreover, for all samples presenting the 214G>C SNP in homo- or heterozygous status in MALDI-TOF MS analysis, it was possible to verify in our previous sequencing analysis [5] the presence of all SNPs correlated to gene conversion to CYP2D7P in Intron 1 (Figure 4), which indicated the reliability of MALDI-TOF analysis for this variation.

4. Conclusions

Differences in drug responses could be due to genetic factors. Knowledge of individual genetic profiling is clinically important and provides benefits for future medical care by predicting the drug response or developing DNA-based tests. Substantial interindividual variability in response to specific therapies might be caused by the presence of polymorphisms in genes encoding components of drug metabolism pathways, such as the CYP450 family genes. Polymorphisms in CYP2D6 gene have been thoroughly investigated, including their associations with the incidence of adverse reactions. In this study, we have developed a reliable medium-throughput genotyping platform using the Sequenom MassARRAY system to provide a simultaneous screening of the most relevant CYP2D6 gene variants in several hundreds of subjects. MALDI-TOF MS-based analyses have the potential to become a useful approach in clinical diagnoses, as they are very flexible and applicable to individualized genetic therapies. The screening platform developed in this study, coupled with The CYP2D6 Applied Biosystems CNV Assay, provides a robust alternative to many currently available CYP450-genotyping approaches and aims to increase the number of responders and to limit the incidences of adverse events. Moreover, by modifying long PCR Forward primer, we have implemented a rapid strategy to infer the phase by direct analysis using MALDI-TOS MS multiplex assays. Concordance between data found in this work and our direct genomic DNA sequencing analysis done in [5] reliably validated our MALDI-TOF MS-based platform.

Conflict of Interests

The authors declare not to have a financial relation with the commercial identities mentioned in the paper that might lead to a conflict of interests.

Acknowledgments

The authors gratefully acknowledge Professor Francesco Cucca, INN-CNR Cagliari Director, for gently furnishing Sardinian DNAs; Dr. Luisella Saba and Dr. Elena Congeddu for useful initial information in MALDI-TOF MS technology; Dr. Enrico Sorisio, PharmaNess Sole Director, for his helpful suggestions; Professor Annalisa Marchi, Professor of Genetics at the Faculty of Biology and Pharmacy, University of Cagliari, for her valuable feedback and support.

References

  1. M. Ingelman-Sundberg, S. C. Sim, A. Gomez, and C. Rodriguez-Antona, “Influence of cytochrome P450 polymorphisms on drug therapies: pharmacogenetic, pharmacoepigenetic and clinical aspects,” Pharmacology & Therapeutics, vol. 116, no. 3, pp. 496–526, 2007. View at: Publisher Site | Google Scholar
  2. M. Ingelman-Sundberg, “Pharmacogenetics of cytochrome P450 and its applications in drug therapy: the past, present and future,” Trends in Pharmacological Sciences, vol. 25, no. 4, pp. 193–200, 2004. View at: Publisher Site | Google Scholar
  3. J. Ragoussis, “Genotyping technologies for all,” Drug Discovery Today: Technologies, vol. 3, no. 2, pp. 115–122, 2006. View at: Publisher Site | Google Scholar
  4. M. Falzoi, A. Mossa, E. Congeddu, L. Saba, and L. Pani, “Multiplex genotyping of CYP3A4, CYP3A5, CYP2C9 and CYP2C19 SNPs using MALDI-TOF mass spectrometry,” Pharmacogenomics, vol. 11, no. 4, pp. 559–571, 2010. View at: Publisher Site | Google Scholar
  5. M. Falzoi, L. Pira, P. Lazzari, and L. Pani , “Analysis of CYP2D6 allele frequencies and identification of novel SNPs and sequence variations in Sardinians,” ISRN Genetics, vol. 2013, Article ID 204560, 10 pages, 2013. View at: Publisher Site | Google Scholar
  6. D. van den Boom and M. Ehrich, “Discovery and identification of sequence polymorphisms and mutations with MALDI-TOF MS,” Methods in Molecular Biology, vol. 366, pp. 287–306, 2007. View at: Publisher Site | Google Scholar
  7. Human Cytochrome P450 Allele Nomenclature Committee, http://www.cypalleles.ki.se/.
  8. NCBI Single Nucleotide Polymorphism dbSNP, http://www.ncbi.nlm.nih.gov/projects/SNP/.
  9. J. Sistonen, A. Sajantila, O. Lao, J. Corander, G. Barbujani, and S. Fuselli, “CYP2D6 worldwide genetic variation shows high frequency of altered activity variants and no continental structure,” Pharmacogenetics and Genomics, vol. 17, no. 2, pp. 93–101, 2007. View at: Publisher Site | Google Scholar
  10. S. Fuselli, I. Dupanloup, E. Frigato et al., “Molecular diversity at the CYP2D6 locus in the Mediterranean region,” European Journal of Human Genetics, vol. 12, no. 11, pp. 916–924, 2004. View at: Publisher Site | Google Scholar
  11. C. Sachse, J. Brockmöller, S. Bauer, and I. Roots, “Cytochrome P450 2D6 variants in a Caucasian population: allele frequencies and phenotypic consequences,” American Journal of Human Genetics, vol. 60, no. 2, pp. 284–295, 1997. View at: Google Scholar
  12. S. Raimundo, C. Toscano, K. Klein et al., “A novel intronic mutation, 2988G>A, with high predictivity for impaired function of cytochrome P450 2D6 in white subjects,” Clinical Pharmacology and Therapeutics, vol. 76, no. 2, pp. 128–138, 2004. View at: Publisher Site | Google Scholar
  13. L. D. Bradford, “CYP2D6 allele frequency in European Caucasians, Asians, Africans and their descendants,” Pharmacogenomics, vol. 3, no. 2, pp. 229–243, 2002. View at: Publisher Site | Google Scholar
  14. D. Marez, M. Legrand, N. Sabbagh et al., “Polymorphism of the cytochrome P450 CYP2D6 gene in a European population: characterization of 48 mutations and 53 alleles, their frequencies and evolution,” Pharmacogenetics, vol. 7, no. 3, pp. 193–202, 1997. View at: Publisher Site | Google Scholar
  15. M. Ingelman-Sundberg, “Implications of polymorphic cytochrome P450-dependent drug metabolism for drug development,” Drug Metabolism and Disposition, vol. 29, no. 4, part 2, pp. 570–573, 2001. View at: Google Scholar
  16. T. Shimada, F. Tsumura, H. Yamazaki, F. P. Guengerich, and K. Inoue, “Characterization of (+/−)-bufuralol hydroxylation activities in liver microsomes of Japanese and Caucasian subjects genotyped for CYP2D6,” Pharmacogenetics, vol. 11, no. 2, pp. 143–156, 2001. View at: Publisher Site | Google Scholar
  17. ss469415642, CYP2D6 3176C>T, 2011, http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ss.cgi?ss=469415642.
  18. ss469415643, CYP2D6 3948T>G, 2011, http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ss.cgi?ss=469415643.
  19. I. Johansson, E. Lundqvist, M. L. Dahl, and M. Ingelman-Sundberg, “PCR-based genotyping for duplicated and deleted CYP2D6 genes,” Pharmacogenetics, vol. 6, no. 4, pp. 351–355, 1996. View at: Google Scholar
  20. QIAGEN LongRange PCR Handbook, 2008, http://www.qiagen.com/default.aspx.
  21. ss470263991, CYP2D6 -948C>A, 2011, http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ss.cgi?ss=470263991.
  22. M. Falzoi, L. Pira, P. Lazzari, and L. Pani, Homo sapiens haplotype 1 cytochrome P450 2D6 variant (CYP2D6) gene, CYP2D62M allele, complete cds, GenBank: JN716373.1, 2011, http://www.ncbi.nlm.nih.gov/nuccore/JN716373.1.
  23. M. Falzoi, L. Pira, P. Lazzari, and L. Pani, Homo sapiens haplotype 2 cytochrome P450 2D6 variant (CYP2D6) gene, CYP2D62M allele, complete cdsGenBank: JN716374.1, 2011, http://www.ncbi.nlm.nih.gov/nuccore/JN716374.1.
  24. M. Falzoi, L. Pira, P. Lazzari, and L. Pani, Homo sapiens haplotype 3 cytochrome P450 2D6 variant (CYP2D6) gene, CYP2D62M/CYP2D641 hybrid allele, complete cds, GenBank: JN716375.1, 2011, http://www.ncbi.nlm.nih.gov/nuccore/JN716375.1.
  25. M. Falzoi, L. Pira, P. Lazzari, and L. Pani, Homo sapiens haplotype 4 cytochrome P450 2D6 variant (CYP2D6) gene, CYP2D62M/CYP2D641 hybrid allele, complete cds, GenBank: JN716376.1, 2011, http://www.ncbi.nlm.nih.gov/nuccore/JN716376.1.
  26. P. Oeth, M. Beaulieu, C. Park et al., Sequenom Application Note, April 2005.
  27. iPLEX Gold Application Guide, 2009, http://www.sequenom.com/Files/Genetic-Analysis-Files/iPLEX-Application-PDFs/iPLEX-Gold-Application-Guide-v2r1.
  28. Sequenom Assay Designer Suite, https://seqpws1.sequenom.com/AssayDesignerSuite.html.
  29. Ensembl Genome Browser, http://www.ensembl.org/index.html.

Copyright © 2013 Matteo Falzoi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views3378
Downloads1393
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.