International Scholarly Research Notices / 2013 / Article / Tab 3

Research Article

Genotyping of CYP2D6 Polymorphisms by MALDI-TOF Mass Spectrometry in Sardinian People

Table 3

Sequences and molecular weights of unextended (UEP) and extended (EP) iPLEX primers.

UEPs’ sequencesUDUMEP lower mass sequencesELMELCEP higher mass sequencesEHMEHC

(1) 13-PLEX
3877G>ACCTTCCGCTTCCACCCCF CCTTCCGCTTCCACCCCA ACCTTCCGCTTCCACCCCG G
3183G>ACCGCACCTGCCCTATCAR CCGCACCTGCCCTATCAC GCCGCACCTGCCCTATCAT A
2615_2617 delAAGGGCAGCCACTCTCACCTR GGCAGCCACTCTCACCTC delGGCAGCCACTCTCACCTT AGA
2483G>TGCGTAGGACCTTGCCAGR GCGTAGGACCTTGCCAGC GGCGTAGGACCTTGCCAGA T
3853G>AGAAGCGGAAGGGCTTCTR GAAGCGGAAGGGCTTCTC GGAAGCGGAAGGGCTTCTT A
3277T>CTGCAGCGCTTTGGGGACAF TGCAGCGCTTTGGGGACAC CTGCAGCGCTTTGGGGACAT T
4180G>CAGCTCATAGGGGGATGGGR AGCTCATAGGGGGATGGGC GAGCTCATAGGGGGATGGGG C
2939G>ATGGGCTCACGCTGCACATCR TGGGCTCACGCTGCACATCC GTGGGCTCACGCTGCACATCT A
3288G>AGATGTCATATGGGTCACACR GATGTCATATGGGTCACACC GGATGTCATATGGGTCACACT A
3176C>TGGCCGTGTCCAACAGGAGATF GGCCGTGTCCAACAGGAGATC CGGCCGTGTCCAACAGGAGATT T
2850C>TAGCTTCAATGATGAGAACCTGF AGCTTCAATGATGAGAACCTGC CAGCTTCAATGATGAGAACCTGT T
2935A>CAGTGCTCACGCTGCACATCCGGAR AGTGCTCACGCTGCACATCCGGAG CAGTGCTCACGCTGCACATCCGGAT A
1757C>TTTGTGCCGCCTTCGCCAACCACTCF TTGTGCCGCCTTCGCCAACCACTCC CTTGTGCCGCCTTCGCCAACCACTCT T

(2) 14-PLEX
1661G>CCAGAGGCGCTTCTCCGTF CAGAGGCGCTTCTCCGTC CCAGAGGCGCTTCTCCGTG G
1869T>CACGGCTTTGTCCAAGAGR ACGGCTTTGTCCAAGAGA TACGGCTTTGTCCAAGAGG C
1846G>AGGGGCGAAAGGGGCGTCR GGGGCGAAAGGGGCGTCC GGGGGCGAAAGGGGCGTCT A
214G>CTGGAGGGCGGCAGAGGTF TGGAGGGCGGCAGAGGTC CTGGAGGGCGGCAGAGGTG G
19G>ACTGGGGCTAGAAGCACTGF CTGGGGCTAGAAGCACTGA ACTGGGGCTAGAAGCACTGG G
1707delTGCGGCCTCCTCGGTCACCCR GCGGCCTCCTCGGTCACCCC delGCGGCCTCCTCGGTCACCCA T
746C>GGCGACCCAGCCTCCTGATCR GCGACCCAGCCTCCTGATCC GGCGACCCAGCCTCCTGATCG C
997C>GGAACAGGCGGGCGGTCGGCR GAACAGGCGGGCGGTCGGCC GGAACAGGCGGGCGGTCGGCG C
100C>TAATGCTGGGCTGCACGCTACF AATGCTGGGCTGCACGCTACC CAATGCTGGGCTGCACGCTACT T
1979T>CGGACAGCCCGACTCCTCCTTCR GGACAGCCCGACTCCTCCTTCA TGGACAGCCCGACTCCTCCTTCG C
-948C>ACAGGCTGGGGCAAGGGCCTTCF CAGGCTGGGGCAAGGGCCTTCC CCAGGCTGGGGCAAGGGCCTTCA A
1749A>GGCCCATCACCCACCGGAGTGGTR GCCCATCACCCACCGGAGTGGTC GGCCCATCACCCACCGGAGTGGTT A
77G>AGTAGCGTGCAGCCCAGCGTTGGR GTAGCGTGCAGCCCAGCGTTGGC GGTAGCGTGCAGCCCAGCGTTGGT A
1513C>TAGCTGGACAGAGCCAGGGACTGF AGCTGGACAGAGCCAGGGACTGC CAGCTGGACAGAGCCAGGGACTGT T

(3) 13-PLEX
984A>GGCGAGTGTCCTCGCCGR GCGAGTGTCCTCGCCGC GGCGAGTGTCCTCGCCGT A
1863_1864ins TTTCGCCCCGACGCCCCTTTCGCCCCF GACGCCCCTTTCGCCCCA GACGCCCCTTTCGCCCCT TTTCGCCCC
1039C>TACCCAGATCCTGGGTTTF ACCCAGATCCTGGGTTTC CACCCAGATCCTGGGTTTT T
1943G>ACCAGCAGCCTGAGGAAGR CCAGCAGCCTGAGGAAGC GCCAGCAGCCTGAGGAAGT A
974C>ACGGCCGTGCGCGAGGCGF CGGCCGTGCGCGAGGCGC CCGGCCGTGCGCGAGGCGA A
1704C>GGGCAAGAAGTCGCTGGAGF GGCAAGAAGTCGCTGGAGC CGGCAAGAAGTCGCTGGAGG G
310G>TTAAATGCCCTTCTCCAGGAR TAAATGCCCTTCTCCAGGAC GTAAATGCCCTTCTCCAGGAA T
957C>TGTCGTGCTCAATGGGCTGGF GTCGTGCTCAATGGGCTGGC CGTCGTGCTCAATGGGCTGGT T
883G>CTCCCCGAAGCGGCGCCGCAAR TCCCCGAAGCGGCGCCGCAAC GTCCCCGAAGCGGCGCCGCAAG C
1659G>ACGCGAGCAGAGGCGCTTCTCCF CGCGAGCAGAGGCGCTTCTCCA ACGCGAGCAGAGGCGCTTCTCCG G
31G>AAGCAGGAAGATGGCCACTATCAR AGCAGGAAGATGGCCACTATCAC GAGCAGGAAGATGGCCACTATCAT A
1724C>TGCGAAGGCGGCACAAAGGCAGGCR GCGAAGGCGGCACAAAGGCAGGCA TGCGAAGGCGGCACAAAGGCAGGCG C
124G>ATCACATGCAGCAGGTTGCCCAGCCR TCACATGCAGCAGGTTGCCCAGCCC GTCACATGCAGCAGGTTGCCCAGCCT A

(4) 14-PLEX
3198C>GACCCATCTCTGGTCGCCR ACCCATCTCTGGTCGCCC GACCCATCTCTGGTCGCCG C
2549delATGGGTCCCAGGTCATCCR TGGGTCCCAGGTCATCCG delTGGGTCCCAGGTCATCCT A
3582A>GGAATGTTGGAGGACCCAF GAATGTTGGAGGACCCAA AGAATGTTGGAGGACCCAG G
2539_2542 delAACTACAGCTGGATGAGCTGCTF ACAGCTGGATGAGCTGCTA AACTACAGCTGGATGAGCTGCTG del
3790C>TCCACTCTCACCCTGCATCTF CCACTCTCACCCTGCATCTC CCCACTCTCACCCTGCATCTT T
4115C>TACCTCCCTGCTGCAGCACTTF ACCTCCCTGCTGCAGCACTTC CACCTCCCTGCTGCAGCACTTT T
4481G>AGAATCTGACTGCCCAGATTGF GAATCTGACTGCCCAGATTGA AGAATCTGACTGCCCAGATTGG G
3828G>AACTCATCACCAACCTGTCATCF ACTCATCACCAACCTGTCATCA AACTCATCACCAACCTGTCATCG G
3384A>CCATGCTGGGGCTATCACCAGGR CATGCTGGGGCTATCACCAGGG CCATGCTGGGGCTATCACCAGGT A
2853A>CGAGAACAGGTCAGCCACCACTAR GAGAACAGGTCAGCCACCACTAG CGAGAACAGGTCAGCCACCACTAT A
2988G>ACATGTGCCCCCGCCTGTACCCTTR CATGTGCCCCCGCCTGTACCCTTC GCATGTGCCCCCGCCTGTACCCTTT A
3584G>AGTCAGAATGTTGGAGGACCCAACF GTCAGAATGTTGGAGGACCCAACA AGTCAGAATGTTGGAGGACCCAACG G
4401C>TTAACTGACATCTGCTCAGCCTCAACR TAACTGACATCTGCTCAGCCTCAACA TTAACTGACATCTGCTCAGCCTCAACG C
2587_2590 delGACTATCAGCTCAGCCCCCCCGAGACCTGAF ATCAGCTCAGCCCCCCCGAGACCTGAC GACTATCAGCTCAGCCCCCCCGAGACCTGAG del

(5) 15-PLEX
3948T>GTCTCAGCAGGTGCCTGF TCTCAGCAGGTGCCTGG GTCTCAGCAGGTGCCTT T
-1235A>GGCACCACCCAGCCTAATR GCACCACCCAGCCTAATC GGCACCACCCAGCCTAATT A
137_138insTGAAGTCCACATGCAGCAR GAAGTCCACATGCAGCAA TGAAGTCCACATGCAGCAG
4155C>TCAGCCCCGGCCCAGCCACF CAGCCCCGGCCCAGCCACC CCAGCCCCGGCCCAGCCACT T
82C>TGTGTAGCGTGCAGCCCAGCR GTGTAGCGTGCAGCCCAGCA TGTGTAGCGTGCAGCCCAGCG C
-1584C>GCTGGACAACTTGGAAGAACCF CTGGACAACTTGGAAGAACCC CCTGGACAACTTGGAAGAACCG G
2575C>AGACCTGGGACCCAGCCCAGCCF GACCTGGGACCCAGCCCAGCCC CGACCTGGGACCCAGCCCAGCCA A
843T>GACTAGGACCTGTAGTCTGGGGF ACTAGGACCTGTAGTCTGGGGG GACTAGGACCTGTAGTCTGGGGT T
-740C>TACAGACTCACACTGACACTTAGR ACAGACTCACACTGACACTTAGA TACAGACTCACACTGACACTTAGG C
-678G>ACTTTGTGTGGGTGATTTTCTGCF CTTTGTGTGGGTGATTTTCTGCA ACTTTGTGTGGGTGATTTTCTGCG G
-750_-749 delGATGTGACTGGTGTGTGTGAGAGAF TGTGACTGGTGTGTGTGAGAGAA delTGTGACTGGTGTGTGTGAGAGAG GA
2291G>ACACTCGCCAAGTGCCAGCCTCCACR CACTCGCCAAGTGCCAGCCTCCACC GCACTCGCCAAGTGCCAGCCTCCACT A
-1426C>TGTGTGCCACCACGTCTAGCTTTTTR GTGTGCCACCACGTCTAGCTTTTTA TGTGTGCCACCACGTCTAGCTTTTTG C
1758G>T>ATTGTGCCGCCTTCGCCAACCACTCCF TTGTGCCGCCTTCGCCAACCACTCCA ATTGTGCCGCCTTCGCCAACCACTCCG G
TTGTGCCGCCTTCGCCAACCACTCCT T
-1000G>AACATCCTCCCGGGCTGCCTGAGGGTR ACATCCTCCCGGGCTGCCTGAGGGTC GACATCCTCCCGGGCTGCCTGAGGGTT A

UD: Unextended mini–sequencing primer Direction; F: Forward UEP direction; R: Reverse UEP direction; UM: Unextended mini–sequencing primers Mass; ELM: Extended primer Lower Mass; EHM: Extended primer Higher Mass; ELC: Extended primer lower Mass nucleotide Called; EHC: Extended primer higher Mass nucleotide Called; All molecular weight masses are expressed in Dalton (Da).

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.