Knockout of Vasohibin-1 Gene in Mice Results in Healthy Longevity with Reduced Expression of Insulin Receptor, Insulin Receptor Substrate 1, and Insulin Receptor Substrate 2 in Their White Adipose Tissue

<table class="table-group" id="tab2"><tr><td><table class="table"><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr class="thead"><td class="align_left">Genes</td><td class="align_center">Forward (<svg height="11.6425pt" id="M82" style="vertical-align:-0.2063999pt" version="1.1" viewbox="-0.0498162 -11.4361 39.9297 11.6425" width="39.9297pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M153 550H386L412 615L406 623H120L82 318C104 327 142 338 184 338C294 338 347 275 347 187C347 112 305 39 221 39C160 39 119 71 97 89C88 97 80 96 71 90C59 80 50 67 49 57C48 45 52 36 66 23C80 9 123 -12 169 -12C221 -11 288 15 342 59C403 109 431 165 431 225C431 308 366 395 238 395C212 395 165 379 127 364L153 550Z" id="g113-54"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,6.24,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,13.668,0)"><path d="M901 255C861 290 790 361 716 442L694 427L796 280H69V230H796L694 83L716 68C790 149 861 220 901 255Z" id="g117-148"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="954" vert-adv-y="954"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,29.702,0)"><path d="M285 378C315 398 338 416 353 432C373 451 384 474 384 503C384 579 325 635 236 635H235C182 635 136 610 108 579L65 516L85 496C110 533 150 575 205 575C258 575 300 543 300 481C300 407 232 369 141 339L147 310C163 315 188 321 211 321C268 321 338 284 338 192C338 94 288 40 217 40C160 40 119 68 93 91C85 98 77 97 69 91C60 84 47 71 46 58C44 46 48 35 62 22C75 10 116 -12 162 -12C234 -12 424 62 424 224C424 297 373 359 285 376V378Z" id="g113-52"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,35.942,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g></svg>)</td><td class="align_center">Reverse (<svg height="11.6425pt" id="M83" style="vertical-align:-0.2063999pt" version="1.1" viewbox="-0.0498162 -11.4361 39.9297 11.6425" width="39.9297pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M153 550H386L412 615L406 623H120L82 318C104 327 142 338 184 338C294 338 347 275 347 187C347 112 305 39 221 39C160 39 119 71 97 89C88 97 80 96 71 90C59 80 50 67 49 57C48 45 52 36 66 23C80 9 123 -12 169 -12C221 -11 288 15 342 59C403 109 431 165 431 225C431 308 366 395 238 395C212 395 165 379 127 364L153 550Z" id="g113-54"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,6.24,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,13.668,0)"><path d="M901 255C861 290 790 361 716 442L694 427L796 280H69V230H796L694 83L716 68C790 149 861 220 901 255Z" id="g117-148"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="954" vert-adv-y="954"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,29.702,0)"><path d="M285 378C315 398 338 416 353 432C373 451 384 474 384 503C384 579 325 635 236 635H235C182 635 136 610 108 579L65 516L85 496C110 533 150 575 205 575C258 575 300 543 300 481C300 407 232 369 141 339L147 310C163 315 188 321 211 321C268 321 338 284 338 192C338 94 288 40 217 40C160 40 119 68 93 91C85 98 77 97 69 91C60 84 47 71 46 58C44 46 48 35 62 22C75 10 116 -12 162 -12C234 -12 424 62 424 224C424 297 373 359 285 376V378Z" id="g113-52"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,35.942,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g></svg>)</td></tr><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr><td class="align_left">Vash1</td><td class="align_center">GATTCCCATACCAAGTGTGCC</td><td class="align_center">ATGTGGCGGAAGTAGTTCCC</td></tr><tr><td class="align_left">Insr</td><td class="align_center">ATGAGGCCAACCTTCCTGGAA</td><td class="align_center">ACGGGACATTCTCCATGTCT</td></tr><tr><td class="align_left">Irs-1</td><td class="align_center">AGCCCAAAAGCCCAGGAGAATA</td><td class="align_center">TTCCGAGCCAGTCTCTTCTCTA</td></tr><tr><td class="align_left">Irs-2</td><td class="align_center">AGTAAACGGAGGTGGCTACA</td><td class="align_center">AAGCTGCTGAGAAGTCAGGT</td></tr><tr><td class="align_left">Sod2</td><td class="align_center">GGTCGCTTACAGATTGCT</td><td class="align_center">CTCCCAGTTGATTACATTCC</td></tr><tr><td class="align_left">Sirt1</td><td class="align_center">AGTTCCAGCCGTCTCTGTGT</td><td class="align_center">CTCCACGAACAGCTTCACAA</td></tr><tr><td class="align_left">FoxO1</td><td class="align_center">GCTGGGTGTCAGGCTAAGAG</td><td class="align_center">TGGACTGCTCCTCAGTTCCT</td></tr><tr><td class="align_left">Tnf<svg height="6.1673pt" id="M84" style="vertical-align:-0.2063904pt" version="1.1" viewbox="-0.0498162 -5.96091 7.51131 6.1673" width="7.51131pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M545 106L524 126C493 85 467 65 455 65C438 65 427 113 405 238C448 295 498 362 543 439L533 448L478 435C453 386 423 331 398 295H395C370 404 347 448 282 448C169 448 23 309 23 153C23 54 65 -12 128 -12C203 -12 283 70 339 155H341C360 29 380 -12 411 -12C444 -12 491 11 545 106ZM333 204C265 95 210 54 169 54C137 54 113 96 113 171C113 302 191 405 252 405C301 405 318 306 333 204Z" id="g113-223"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="568" vert-adv-y="568"></glyph.data></g></svg></td><td class="align_center">GGGACAGTGACCTGGACTGT</td><td class="align_center">AGGCTGTGCATTGCACCTCA</td></tr><tr><td class="align_left"><svg height="12.7178pt" id="M85" style="vertical-align:-3.42947pt" version="1.1" viewbox="-0.0498162 -9.28833 7.68094 12.7178" width="7.68094pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M558 587C558 666 497 712 432 712C379 712 330 691 284 650C212 586 178 508 148 348L71 -65C49 -185 35 -229 23 -235L27 -261C49 -259 101 -251 124 -224C131 -216 138 -178 159 -24C171 66 197 200 227 356C264 550 295 668 393 668C443 668 479 632 479 575C479 516 446 458 383 418C361 404 344 398 318 397L296 350C395 338 460 281 460 192C460 110 411 40 300 40C258 40 215 55 192 69L181 51C191 18 222 -16 266 -16C308 -16 351 1 397 26C471 67 545 142 545 221C545 315 486 365 401 395C469 437 558 498 558 587Z" id="g113-224"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="581" vert-adv-y="581"></glyph.data></g></svg>-Actin</td><td class="align_center">TCGTGCGTGACATCAAAGAG</td><td class="align_center">TGGACAGTGAGGCCAGGATG</td></tr><tr class="table-tr"><td colspan="3"><hr class="tbody-hr"/></td></tr></table></td></tr></table>

Journal of Aging Research

tab2

Table 2

Table 2: Knockout of Vasohibin-1 Gene in Mice Results in Healthy Longevity with Reduced Expression of Insulin Receptor, Insulin Receptor Substrate 1, and Insulin Receptor Substrate 2 in Their White Adipose Tissue 

Table 2 | Knockout of Vasohibin-1 Gene in Mice Results in Healthy Longevity with Reduced Expression of Insulin Receptor, Insulin Receptor Substrate 1, and Insulin Receptor Substrate 2 in Their White Adipose Tissue 