Table 1: Sequences of primers for real-time PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)Size (bp)

GAPDHCCCAGAAGACTGTGGATGGGGATGCAGGGATGATGTTCT81
Ki-67GACAGCTTCCAAAGCTCACCGTGTCCTTAGCTGCCTCCTG228
PCNATGGAATCCCAGAACAGGAGCCAATGTGGCTAAGGTCTCG87
Col IGCATGGCCAAGAAGACATCCCCTCGGGTTTCCACGTCTC83
Runx-2GCCGGGAATGATGAGAACTATGGGGAGGATTTGTGAAGAC155