Table 1: Summary of the gene-specific PCR primer sequences, the length of amplificated product, the appropriate annealing temperature used in the experiments, and the number of the amplification cycles.

GeneSense primer (5′⟶3′)Antisense primer (5′⟶3′)Product sizeTmCycles

β-ActinAAATCTGGCACCACACCTTAGCACTGTGTTGGCGTAGAG646 bp58°C35
COIIATCTTAATGGCACATGCAGCAGATCTCGGGTGACATTTCGA726 bp58°C35