Research Article
AGEs and Glucose Levels Modulate Type I and III Procollagen mRNA Synthesis in Dermal Fibroblasts Cells Culture
Table 1
Sequences of human primers used for real-time PCR.
| Gene (mRNA) | Oligonucleotide primer sequence (5′-3′) | Amplification fragment | Annealing temperature (˚C) | Calculate | Use |
| Procolagen 1 2 (PCol 12) sense | GTGGTTACTACTGGATTGACC | 331 |
53.4 | 54 | Procolagen 1 2 (PCol12) antisense | TTGCCAGTCTCCTCATCCAT | Procolagen 3 1 (Pcol31) sense | GGAGTAGCAGTAGGAGGAC |
91 | 54 |
54 | Procolagen 1 1 (PCol31) antisense | AACCAGGATGACCAGATGTA | 18S RNA sense | CTCAACACGGGAAACCTCAC | 133 |
53.5 | 54 | 18S RNA antisense | TTATCGGAATTAACCAGACAAATCG |
|
|