Journal of Diabetes Research / 2013 / Article / Tab 1

Research Article

Effect of (dipic-Cl) on Lipid Metabolism Disorders in the Liver of STZ-Induced Diabetic Rats

Table 1

Primers for real-time PCR analysis.

GeneForward primerReverse primer

β-actin AAGATCATTGCTCCTCCTGAGCCGTACTCCTGCTTGCTGATCCA
FAT/CD36 AATCCTCTCCCTCTCTGGTGTCCATGGCGAGGAACAGAACAT
FABP1 CTTCTCCGGCAAGTACCAAGTGCCCTTGATGTCCTTCCCTTTCT
FATP5 CCTGCCAAGCTTCGTGCTAATGCTCATGTGATAGGATGGCTGG
Cpt1αGATCCACCATTCCACTCTGCTCTGTGCCTGCTGTCCTTGATATG
ACOX1 AGATTCAAGACAAAGCCGTCCATGATGCTCCCCTCAAGAAAGTC
ApoB CAGCCAATAATGTGAGCCCCTATCCTATGCGCTTCCTGCTCTT
LXR CCTATGTCTCCATCAACCACCCACTTGCTCTGAATGGACGCTG
PXR GTGGAGCTAAAGAGCATGTGGCTTCCTCCACACTTGGCATTTG
AhR GCCAATACGCACCAAAAGCACCTGTTGGATCAAGGCACTCAT

FAT/CD36: fatty acid translocase; FABP1: fatty acid bounding protein1; FATP5: fatty acid transporter5; Cpt1α: carnitine palmitoyltransferase I α; ACOX1: peroxisomal acyl-coenzyme A oxidase 1; ApoB: apolipoprotein B; LXR: liver X receptor; PXR: pregnane X receptor; AhR: aryl hydrocarbon receptor.