Journal of Diabetes Research / 2014 / Article / Tab 5

Research Article

miR-375 and miR-30d in the Effect of Chromium-Containing Chinese Medicine Moderating Glucose Metabolism

Table 5

Differentially expressed miRNAs (fold > 2, ).

rno miRNA geneFold change valueChromosomal locationMature sequence

rno-miR-4482.1750.04844Xq14UUGCAUAUGUAGGAUGUCCCA
rno-let-7b3.7400.022077q34UGAGGUAGUAGGUUGUGUGGU
rno-miR-5402.8990.042786q32AGGUCAGAGGUCGAUCCUG
rno-miR-2963.0540.029553q42GAGGGUUGGGUGGAGGCUCUCC
rno-miR-8802.0690.03130Xq37UACUCCAUUCAUUCUGAGUAG
rno-miR-200a2.4930.019335q36UAACACUGUCUGGUAACGAUG
rno-miR-5002.0100.01848Xq13AAUGCACCUGGGCAAGGGUUCA
rno-miR-10b3.4130.041383q23CCCUGUAGAACCGAAUUUGUG
rno-miR-3363.7210.0074610q22UCACCCUUCCAUAUCUAGUC
rno-miR-30d2.5310.018367q34UGUAAACAUCCCCGACUGGAA
rno-miR-2082.3000.4672815p13AUAAGACGAGCAAAAAGCUUG
rno-let-7e3.2680.023071q12UGAGGUAGGAGGUUGUAUAGU
rno-miR-142-5p3.5820.0048310q26CAUAAAGUAGAAAGCACUACU
rno-miR-8743.7510.0142917p14CUGCCCUGGCCCGAGGGACCG
rno-miR-3753.4120.029339q33UUUGUUCGUUCGGCUCGCGUG
rno-miR-8793.2990.006344q12AGAGGCUUAUAGCUCUAAGC
rno-miR-5013.5340.01714Xq13AAUCCUUUGUCCCUGGGUGAA
rno-miR-1882.6090.03009Xq13CAUCCCUUGCAUGGUGGAGGG
rno-miR-301b0.3540.0532311q23CAGUGCAAUGGUAUUGUCAAAG
rno-miR-1340.4580.002986q32UGUGACUGGUUGACCAGAGGGG
rno-miR-6520.4770.01357Xq14AAUGGCGCCACUAGGGUUGU