Journal of Diabetes Research / 2015 / Article / Tab 1

Research Article

Nutrient Induced Type 2 and Chemical Induced Type 1 Experimental Diabetes Differently Modulate Gastric GLP-1 Receptor Expression

Table 1


Gene nameForward sequenceReverse sequence

GLP-1R [9]GGGTCTCTGGCTACATAAGGACAAC AAGGATGGCTGAAGCGATGAC
GAPDHCAGGAGCGAGATCCCGCCCTTTTGGCCCCACCCT

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.