Association Study between BGLAP Gene HindIII Polymorphism and Type 2 Diabetes Mellitus Development in Ukrainian Population

Table 1

Primer sequences and PCR conditions.

Primer sequence	PCR conditions ( cycles)			Amplicon length	Restriction fragments
	D	H	E
Fwd: 5CCGCAGCTCCCAACCACAATAAGCT3	94°C for 30 s	56°C for 60 s	72°C for 60 s	253	TT 232; 21
					TC 253; 232; 21
Rev: 5CAATAGGGCGAGGAGT3
					CC 253

PCR: polymerase chain reaction; D: denaturation; H: hybridization; E: elongation; Fwd: forward primer; Rev: reverse primer.