Characteristics of Gut Microbiota in Female Patients with Diabetic Microvascular Complications

<table class="table-group" id="tab1"><tr><td><table class="table"><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr class="thead"><td class="align_left">Name</td><td class="align_center">Upstream primer (forward <span class="nowrap"><svg height="11.6295pt" id="M9" style="vertical-align:-0.1934004pt" version="1.1" viewbox="-0.0498162 -11.4361 45.8408 11.6295" width="45.8408pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M137 515H396L428 613L422 623H104L59 307C80 314 123 327 169 327C260 327 316 267 316 175C316 98 286 45 221 45C166 45 118 84 94 106C81 117 70 121 59 112C41 99 27 77 27 61C27 46 32 36 52 20C73 2 115 -12 155 -12C216 -11 287 14 343 54C413 104 444 164 444 227C444 316 371 399 243 399C217 399 160 384 111 365L137 515Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,6.316,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g><g transform="matrix(.013,0,0,-0.013,13.743,0)"><path d="M567 230V280H69V230H567Z"></path></g><g transform="matrix(.013,0,0,-0.013,19.519,0)"><path d="M901 255C861 290 790 361 716 442L694 427L796 280H69V230H796L694 83L716 68C790 149 861 220 901 255Z"></path></g><g transform="matrix(.013,0,0,-0.013,35.63,0)"><path d="M295 385C328 406 353 421 370 436C390 452 402 476 402 502C402 578 343 635 239 635H238C172 635 124 606 97 574L48 506L74 482C102 521 141 558 194 558C239 558 278 530 278 469S219 366 134 339L141 307C156 311 177 313 195 313C246 313 314 274 314 177C314 79 276 43 226 43C166 43 117 89 95 108C82 118 70 116 58 107C45 97 29 80 29 61C29 47 36 34 53 21C73 5 114 -12 164 -12C226 -12 444 54 444 224C444 299 391 365 295 383V385Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,41.946,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>)</span></td><td class="align_center">Downstream primer (reverse <span class="nowrap"><svg height="11.6295pt" id="M10" style="vertical-align:-0.1934004pt" version="1.1" viewbox="-0.0498162 -11.4361 45.8408 11.6295" width="45.8408pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M137 515H396L428 613L422 623H104L59 307C80 314 123 327 169 327C260 327 316 267 316 175C316 98 286 45 221 45C166 45 118 84 94 106C81 117 70 121 59 112C41 99 27 77 27 61C27 46 32 36 52 20C73 2 115 -12 155 -12C216 -11 287 14 343 54C413 104 444 164 444 227C444 316 371 399 243 399C217 399 160 384 111 365L137 515Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,6.316,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g><g transform="matrix(.013,0,0,-0.013,13.743,0)"><path d="M567 230V280H69V230H567Z"></path></g><g transform="matrix(.013,0,0,-0.013,19.519,0)"><path d="M901 255C861 290 790 361 716 442L694 427L796 280H69V230H796L694 83L716 68C790 149 861 220 901 255Z"></path></g><g transform="matrix(.013,0,0,-0.013,35.63,0)"><path d="M295 385C328 406 353 421 370 436C390 452 402 476 402 502C402 578 343 635 239 635H238C172 635 124 606 97 574L48 506L74 482C102 521 141 558 194 558C239 558 278 530 278 469S219 366 134 339L141 307C156 311 177 313 195 313C246 313 314 274 314 177C314 79 276 43 226 43C166 43 117 89 95 108C82 118 70 116 58 107C45 97 29 80 29 61C29 47 36 34 53 21C73 5 114 -12 164 -12C226 -12 444 54 444 224C444 299 391 365 295 383V385Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,41.946,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>)</span></td></tr><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr><td class="align_left"><i>Bacteroides</i></td><td class="align_center">CTGAACCAGCCAAGTAGCG</td><td class="align_center">CCGCAAACTTTCACAACTGACTTA</td></tr><tr><td class="align_left"><i>Prevotella</i></td><td class="align_center">CCAGCCAAGTAGCGTGCA</td><td class="align_center">TGGACCTTCCGTATTACCGC</td></tr><tr><td class="align_left"><i>Bifidobacterium</i> spp</td><td class="align_center">TCGCGTC (C/T)GGTGTGAAAG</td><td class="align_center">CCACATCCAGC (A/G)TCCAC</td></tr><tr><td class="align_left"><i>Lactobacillus</i></td><td class="align_center">AGCAGTAGGGAATCTTCCA</td><td class="align_center">CACCGCTACACATGGAG</td></tr><tr><td class="align_left"><i>Faecalibacterium prausnitzii</i></td><td class="align_center">CCCTTCAGTGCCGCAGT</td><td class="align_center">GTCGCAGGATGTCAAGAC</td></tr><tr><td class="align_left"><i>Enterococcus</i> spp</td><td class="align_center">CCCTTATTGTTAGTTGCCATC</td><td class="align_center">ACTCGTTGTACTTCCCATTGTATT</td></tr><tr><td class="align_left"><i>Eubacterium rectale</i></td><td class="align_center">GGAATATTGCACAATGGGC</td><td class="align_center">AGCCGGTGCTTCTTAGTCAG</td></tr><tr><td class="align_left"><i>Veillonellaceae</i></td><td class="align_center">CCCGGGCCTTGTACACACCG</td><td class="align_center">CCCACCGGCTTTGGGCACTT</td></tr><tr><td class="align_left"><i>Clostridium leptum</i></td><td class="align_center">GCACAAGCAGTGGAGT</td><td class="align_center">CTTCCTCCGTTTTGTCAA</td></tr><tr><td class="align_left"><i>Roseburia inulinivorans</i></td><td class="align_center">TCTGACCGGACAGTAATGTG</td><td class="align_center">CGCTGGCTACTGGGGATAAG</td></tr><tr><td class="align_left">Internal parameters</td><td class="align_center">CGTCAGCTCGTGYCGTGAG</td><td class="align_center">CGTCRTCCCCRCCTTCC</td></tr><tr class="table-tr"><td colspan="3"><hr class="tbody-hr"/></td></tr></table></td></tr></table>

<div>Primer sequences of the intestinal bacterial genus.</div>

Journal of Diabetes Research

tab1

Table 1

Table 1: Characteristics of Gut Microbiota in Female Patients with Diabetic Microvascular Complications 