Journal of Immunology Research / 2012 / Article / Tab 1

Research Article

Contribution of the Infection-Associated Complement Regulator-Acquiring Surface Protein 4 (ErpC) to Complement Resistance of Borrelia burgdorferi

Table 1

Oligonucleotides used in this study.

OligonucleotideSequence (5′–3′) Use in this work

ErpC 5nc(+)GTTGTATGTGTTTTGAAGCTTTTAGTAATGAGCAGGGCCloning in pKFSS1 and amplification of erpC
HindIII
ErpC 3nc(−)CGATCTCTCCTGTATTTTAAGCTTCTATTTTAAATTTTTCTTAAGCloning in pKFSS1 and amplification of of erpC
HindIII
aadA + NdeICATATGAGGGAAGCGGTGATCAmplification of aadA gene
aadR + AatIIGACGTCATTATTTGCCGACTACCAmplification of aadA gene
Fla6AACACACCAGCATCGCTTTCAGGGTCTAmplification of flaB gene
Fla7TATAGATTCAAGTCTATTTTGGAAAGCACCTAAmplification of flaB gene

Sequences of specific restriction endonuclease recognition sites are underlined.

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.