Journal of Immunology Research / 2012 / Article / Tab 1

Research Article

Early Oral Ovalbumin Exposure during Maternal Milk Feeding Prevents Spontaneous Allergic Sensitization in Allergy-Prone Rat Pups

Table 1


GeneForward primerReverse primer

TGF-β1TGCGCCTGCAGAGATTCAAGTCAAAAAGACAGCCACTCAGGCGTATCA
Smad2TGAGCTTGAGAAAGCCATCATGTGTCCCACTGATCTACCG
Smad4GGCATTGGTGTAGACGACCTGGGGTTTCTTTGATGCTCTG
iSmad7GCAGCAGTTACCCCATCTTCTGATGGAGAAACCAGGGAAC
FoxP3CCACACCTCCTCTTCTTCCTTTGACTAGGGGCACTGTAGGC
Cyclophilin AGGTTGGATGGCAAGCATGTGTGCTGGTCTTGCCATTCCTG

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.