Table 1

PrimerSequence ()Comment

GR5PCGACTGGAGCACGAGGACACTGAAdaptor of 5′ RACE
GR5NPGGACACTGACATGGACTGAAGGAGTAAdaptor of 5′ RACE
GR3PGCTGTCAACGATACGCTACGTAACGAdaptor of 3′ RACE
GR3NPCGCTACGTAACGGCATGACAGTGAdaptor of 3′ RACE
CD63-R1GATGGTCAGAAACAGGCCAAAGAAA5′ RACE primer of First PCR
CD63-F1GCAGACACTTCCACAGCGACGACAG3′ RACE primer of First PCR
CD63-R2CCGAAGCGAATAAACAAGCCCAGTCCGAAA5′ RACE primer of Nest PCR
CD63-F2TCATCTGGGACGCCACCCTTGGAAGTAC3′ RACE primer of Nest PCR
CD63-QFTAGATAAGGGATGTTACGACReal-time PCR for Pu-CD63
CD63-QRTTCATGCTACACAAAATTACReal-time PCR for Pu-CD63
GAPDH-QFACTCGGAAAGGAGACCACCTACCAReal-time PCR of GAPDH
GAPDH-QRGAAACGACCTGATCCTCGGTGTAGReal-time PCR of GAPDH
Luc-QFGCTGGTGCCAACCCTATTCTCCReal-time PCR of Luc
Luc-QRAACCGCTTCCCCGACTTCCTTAReal-time PCR of Luc
CD63-OFATGGGTTTTGTTTCGACACTCGCCAGORF check for Pu-CD63
CD63-ORCTAAAAGTCTTTATGACCTGTCTTGORF check for Pu-CD63
RiCD63-FTAATACGACTCACTATAGGGAGAGGGCTTGTTTATTCGCTTCGGGTCARNAi primer for CD63
RiCD63-RTAATACGACTCACTATAGGGAGATAGTTGTTTGCTGTCGTCGCTGTGGRNAi primer for CD63
RiLuc-FTAATACGACTCACTATAGGGAGAGTCCGTTCGGTTGGCAGAAGCTATGRNAi primer for Luc
RiLuc-RTAATACGACTCACTATAGGGAGACATGCGAGAATCTCACGCAGGCAGTRNAi primer for Luc

“F” indicates the forward primer; “R” indicates the reverse primer.