Table 1: List of primers used in reverse transcriptase-polymerase chain reaction.

NameSense primer (5–3)Antisense primer (5–3)

HLA-DPCACCAACCTGATCCGTAAGACTGTGCCTTCCACTCC
HLA-DQTCTACCGCTGCTACCAATCCACAAGACAAATGAGGG
HLA-DRGGCTTGAAGAATTTGGACTGATCGGAGTATAGTTGGA
ICAM-1GCAAGAAGATAGCCAACCATGCCAGTTCCACCCGTTC
CD80CCACCTTGCCCTTTACGTGCCCACCATATTCCTCTA
TGF-βTGTCACGGCAGCCGAATTCCTGGAGCACCTGATAAACG
IL-1ATGACGACGCACTTGTAGCTCAGTCTTCTTCGCCTTT
IL-4GCAGTTCCACAGGCACAATGGTTGGCTTCCTTCACA
IL-6GGAGACTTGCCTGGTGAAACAGCTCTGGCTTGTTCC
IL-12ACTCCAAACCGTTGTCATTAATAGTCCCATCCTTCTTT
IL-17CACCATGTGGCCTAAGAGAGTCCGAAATGAGGCTGT
IL-23AAGCCAGATTTGAGAAGAAGGCAACAGCAGCATTACAG
CCL2AGAATCACCAGCAGCAAGGGAATCCTGAACCCACTT
NFκBACTGGAAGCACGAATGACCAAATAGGCAAGGTCAGG
GAPDHACAACTTTGGTATCGTGGAACACAGTCTTCTGGGTGGC