Table 1: Primers used in this study in terms of identification of strains.

Oligos names5′- - - -3′SizeTargeted species
For Group 1 Bacillus Identification

Ba.IdMa-FGCGCAGTCCGTGCCTTACGGCGT828 pbB. amyloliquefaciens
Ba.IdMa-RTTACTGAGCTGCCGCCTGTACG
Ba.SHMa-FTACAACTCTCACGGAACTCACGTTGCC461 pb
Ba.SHMa-RTATTTGTTTCCAGGAAGCGTG

Bl.Id.Ma-FGCGCAAACCGTTCCTTACGGCAT825pbB. licheniformis
Bl.Id.Ma-RTTATTGAGCGGCAGCTTCGAC
Bl.SHMa-FGGCAACGGACACGGCACACATGTTGC461 pb
Bl.SHMa-RTAAGTGTTCGTTGGGTAAGTG

Bs.Id.Ma-FGCGCAATCTGTTCCTTATGGCAT835 pbB. subtilis
Bs.Id.Ma-RTTATTGTGCAGCTGCTTGTACGTTGA
Bs.SHMa-FGGCAGTTCTCACGGTACGCATGTAGCC461 pb
Bs.SHMa-RTAAGTGCCTCCAGGAAGTGTG

Bp.Id.Ma-FGCACAAACCGTCCCTTATGGAAT828 pbB. pumilus
Bp.Id.Ma-RTTAGTTAGAAGCCGCTTGAGCG
Bp.SHMa-FTTTCAATCACATGGAACTCACGTAGCC461 pb
Bp.SHMa-RTATCCACTGCTTGGTACTGTA

Bm.Id.Ma-FGCGCAATCTGTTCCTTACGGCAT837 pbB. mojavensis
Bm.Id.Ma-RTTATTGTGCAGCTGCCTGCAC
Bm.SHMa-FGGCAGTTCTCACGGCACGCATGTAGCC461 pb
Bm.SHMa-RTATGTGCCGCCAGGAAGTGTG

Bsa.Id.Ma-FGCACAAACCGTCCCTTATGGAAT828 pbB. safensis
Bsa.Id.Ma-RTTAGTTAGAAGCCGCTTGAACGTTG
Bsa.SHMa-FTTTCAATCACATGGAACTCACGTAGCA461 pb
Bsa.SHMa-RTATCCACTGCTTGGCACTGTA

Bat.Id.Ma-FGCTCAGTCA GTACCTTATG GCAT828 pbB. atrophaeus
Bat.Id.Ma-RTTATTGCGCTGCTGCCTGAACG
Bat.SHMa-FGGAAATTCACACGGAACTCACG461 pb
Bat.SHMa-RTAGCTGCTGCCCGGAAGTGTG

Bal.Id.Ma-FGGTCAAAGCGTCCCTTATGGTA828 pbB. altitudinis
Bal.Id.Ma-RTTATCGTGCAGCTTTTTGTAC
Bal.SHMa-FCCGCATGAACACGGAACCCACG461 pb
Bal.SHMa-RTATTCGTTATGAGGAATGGTA