Table 2: Primers used in this study for plasmid constructions.

bamACK1FTGGATCCAGAGGCAAAAAGGTATGGATCAGB. amyloliquefaciens
ACK1TGGATCCGCGCAGTCCGTGCCTTACGGCGT
ecoACK2RAGAATTCTTACTGAGCTGCCGCCTGTACG

bamACK3FTGGATCCATGAGGAAAAAGAGTTTTTGGCTTGGGB. licheniformis
ACK2TGCGCAAACCGTTCCTTACGGCAT
xhoACK4RACTCGAGTTATTGAGCGGCAGCTTCGAC

bamACK5FTGGATCCAGAAGCAAAAAATTGTGGATCAGCB. subtilis
ACK3TGGATCCGCGCAATCTGTTCCTTATGGCAT
ecoACK6RAGAATTCTTATTGTGCAGCTGCTTGTACGTTGA

bamACK7FAGGATCCAAAA AGAAAAATGT GATGACAAGTB. pumilus
ACK4GCACAAACCGTCCCTTATGGAAT
ecoACK8RAGAATTCTTAGTTAGAAGCCGCTTGAGCG

bamACK9FAGGATCCAGAAGCAAAAAATTGTGGATCAGCB. mojavensis
ACK5AGCGCAATCTGTTCCTTACGGCAT
ecoACK10RAGAATTCTTATTGTGCAGCTGCCTGCAC

ecoACK11FTGCGTGAAAAAGAAAAATGTGATGACAB. safensis
ACK6GCACAAACCGTCCCTTATGGAAT
xhoACK12RACTCGAGTTAGTTAGAAGCCGCTTGAACGTTG

bamACK13FTGGATCCAGAAGCA GGAAATTATG GATCGGB. atrophaeus
ACK7TGGATCCGCTCAGTCA GTACCTTATG GCAT
ecoACK14RAGAATTCTTATTGCGCTGCTGCCTGAACG

bamACK15FTGGATCCAAGGTCA AATCATTTGG AGCAGGGB. altitudinis
ACK8GGTCAAAGCGTCCCTTATGGTA
ecoACK16RAGAATTCTTATCGTGCAGCTTTTTGTAC