Journal of Nanomaterials / 2018 / Article / Tab 1

Research Article

Effects of Titanium Micro-Nanopermeable Structures on Osteogenic Differentiation

Table 1

Primer sequences.

Gene nameForward primer (5-3)Reverse primer (5-3)

AlpCTGCCTGAAACAGAAAGTCTGCTATGTCTTTACCAGGAGGCGTG
OcnTGAGGACCATCTTTCTGCTCACCTATGGAAGGCTAAGGGCTCTG
OpnTTCTCCTGGCTGAATTCTGAGGGCTGCCAGAATCAGTCACTTTC
Runx2ACGAAAAATTAACGCCAGTCGGCACTTCACCCTCAGGACCG
BspGGCTATTGATCAAGCAGCACACGGGGTGTGATAAAGGAACGTCA
GapdhGTCCCAGCTTAGGTTCATCAGGATGGCAACAATCTCCACTTTGC