Journal of Nanomaterials / 2019 / Article / Tab 1

Research Article

Nanocrystalline Hydroxyapatite-Based Scaffold Adsorbs and Gives Sustained Release of Osteoinductive Growth Factor and Facilitates Bone Regeneration in Mice Ectopic Model

Table 1

Primer sequences used for qPCR.

GeneSequence (5-3)Product length

Runx2Forward: GACTGTGGTTACCGTCATGGC84
Reverse: ACTTGGTTTTTCATAACAGCGGA

OsterixForward: AGCTCACTATGGCTCCAGTC189
Reverse: AGGAGTCCATTGGTGCTTGA

AlpForward: TGGGGGCATAGACTTCAATCA121
Reverse: CTCCGTACCAAAGCCATCAATAG

Col1α1Forward: TTCTCCTGGCAAAGACGGAC247
Reverse: CTCAAGGTCACGGTCACGAA

β-ActinForward: GGCTGTATTCCCCTCCATCG154
Reverse: CCAGTTGGTAACAATGCCATGT

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.