Journal of Nanomaterials

Journal of Nanomaterials / 2020 / Article

Research Article | Open Access

Volume 2020 |Article ID 3068173 | https://doi.org/10.1155/2020/3068173

Zhiping Qi, Xue Chen, Wenlai Guo, Chuan Fu, Su Pan, "Theanine-Modified Graphene Oxide Composite Films for Neural Stem Cells Proliferation and Differentiation", Journal of Nanomaterials, vol. 2020, Article ID 3068173, 10 pages, 2020. https://doi.org/10.1155/2020/3068173

Theanine-Modified Graphene Oxide Composite Films for Neural Stem Cells Proliferation and Differentiation

Academic Editor: Giuseppe Compagnini
Received08 Feb 2020
Revised10 Jun 2020
Accepted17 Jun 2020
Published13 Jul 2020

Abstract

The central nervous system (CNS) injury has been a worldwide clinical problem for regenerative medicine. Nerve tissue engineering is a new strategy for CNS injury. Among kinds of biomaterials, graphene oxide (GO)-based degradable composite materials are considered to be promising in the field of neurogenesis. In this study, GO and L-theanine (TH) were combined by chemical grafting to prepare a new PLGA/GO-TH composite material. X-ray diffraction (XRD), transmission electron microscope (TEM), Fourier-transform infrared spectra (FTIR), contact angle testers, and mechanical testers were performed to obtain characterization of composite materials. The protein adsorption efficiency of the PLGA/GO-TH films was then evaluated. Next, the effect of the composite films on neural stem cell (NSC) survival, proliferation, and differentiation was investigated. Our results indicated that L-theanine was successfully grafted onto GO. PLGA/GO-TH composite film can significantly improve NSC survival, proliferation, and neuronal differentiation. Our results demonstrated that the neurogenesis function of a novel PLGA/GO-TH composite film and its potential as a carrier for the further application in the CNS injury.

1. Introduction

The central nervous system (CNS) injury can always cause sensory and motor dysfunction, which has been difficult to overcome in the regenerative field [1]. Since nerve tissue engineering developed fast in the past years, neurobiological materials are chosen to treat CNS injury as a new strategy [25]. Graphene oxide (GO) is considered to be one of the most promising candidate biomaterials for neurogenesis. GO has excellent physical, chemical, and electrical properties; a large specific surface area; and other special physical and chemical properties [6, 7]. Studies have confirmed that GO can increase the neuronal differentiation rate of embryonic stem cells and neural stem cells, which is beneficial to nerve regeneration [8, 9]. Besides, there are many functional groups present on the surface of GO, facilitating the surface modification of GO with bioactive factor to further enhance the biological functions of GO.

Amino acids are the basic components of proteins. Amino acids contain several functional groups, which could enhance the adhesion of cells or proteins through hydrogen bonding or electrostatic attraction [1012]. In consideration of these functional groups, amino acids could surface-modify some materials by chemical grafting [13]. As a type of amino acid extracted from green tea, L-theanine was identified to have a unique function in the nervous system. First, L-theanine had a clear protective effect on neuronal damage caused by cerebral ischaemia-reperfusion injury and β-amyloid intervention, which may be because of the inhibitory effect of L-theanine on the oxidation/nitrosation stress reaction and inflammatory factor production after central nerve injury [1416]. In addition, L-theanine can promote the proliferation and neuronal differentiation of NSCs by upregulating the Slc38a1 gene and activating the mTOR signalling pathway [17].

To further enhance the bioactivity of GO to promote nerve regeneration, we stably combined L-theanine and GO by chemical grafting. Because of the potential cytotoxicity and nondegradability of high concentrations of GO, biodegradable polymers were used as another component to produce hybrid materials to compensate for this problem. Poly(lactic-co-glycolic acid) (PLGA) is an common degradable materials approved by FDA and has been widely used in nerve tissue engineering. In this study, the PLGA/GO-TH composite film was first prepared, and its characterization was determined. Then, the lysozyme adsorption efficiency of the hybrid material was observed. Next, the effect of the PLGA/GO-TH film on NSC survival, proliferation, and differentiation was measured to evaluate the potential of the L-theanine-modified GO composite materials in nerve regeneration.

2. Materials and Methods

2.1. Materials

PLGA (, ) was purchased from Changchun Sino Biomaterials Co., Ltd, China. GO was purchased from Chengdu Organic Chemicals Co., Ltd., China (thickness: 0.55–1.2 nm; diameter: 0.5–3 mm). L-theanine and lysozyme were purchased from Sigma (USA). NSC culture media components were purchased from PeproTech (USA). Primary antibody including Tuj-1 and GFAP were purchased from Abcam (USA).

2.2. Synthesis of the GO-TH Hybrid

The method for combining amino acids and GO by chemical grafting was followed as previously described. In brief, 0.1 g GO and 0.25 g EDC were first added to a flask, and the mixture was stirred for 1 h with vibration, followed by the addition of 0.3 g of L-theanine, and stirred at room temperature for 24 h. Then, the above mixture was placed into sediment, and the supernatant was replaced with clean distilled water, followed by ultrasonic concussion. This step was repeated 5 times to remove the impurity from the GO-TH hybrid solution, and the GO-TH hybrid was lyophilized and stored.

2.3. Production of the PLGA/GO-TH Composite Film

GO is cytotoxic to some extent, so it is important to control its concentration when used with polymers. Therefore, the concentrations of GO were obtained by referring to lots of references about GO. Previous studies have demonstrated that 2% GO have the best biological activity, and there is no significant cytotoxicity [18]. Therefore, in this study, the ratio of PLGA to GO-TH is 98 : 2. The solution evaporation method was used to obtain PLGA/GO-TH composite film. First, 980 mg PLGA was dissolved in hexafluoroisopropanol and followed by the addition of 20 mg GO-TH. Then, the above solution was magnetically stirred and ultrasonically shaken to thoroughly mix. Part of the solution was spread on a siliconized slide for subsequent cell experiments, and another part was spread in a petri dish for characterization evaluation. The preparation process of the pure PLGA film and the PLGA/GO composite film was the same as that of the PLGA/GO-TH film.

2.4. Characterization

The FTIR spectra (Bruker Tensor 27) were used to evaluate the crosslinking between TH and GO. The morphologies of GO and GO-TH were observed by an H-7650B transmission electron microscope (Hitachi, Japan). XRD (D8 ADVANCE, Germany) was employed to identify the elemental composition. The water contact angle was used to measure the hydrophilia of the hybrid films. A universal mechanical testing machine (Instron 1121, UK) was chosen to determine the mechanical properties of the hybrid films.

2.5. Protein Adsorption Properties

The protein adsorption properties of PLGA, PLGA/GO and PLGA/GO-TH films were analysed by performing a bicinchoninic acid (BCA) protein assay using lysozyme as a model protein. Briefly, the films were first added into 10 mL of lysozyme solution (2 mg/mL), and liquid samples were taken to analyse the solution lysozyme concentration at certain time points. The amount of lysozyme loaded on the films was determined by the reduction in lysozyme concentration through BCA protein assay.

2.6. NSC Survival Assays

NSCs were suspension cultured as previously described [19]. Then, the NSCs were dissociated as single cells and cultured on glass, PLGA, PLGA/GO, and PLGA/GO-TH films. 100 μM H2O2 was added into each well and the culture medium was replaced after 24 h. The cell viability was determined by a CCK-8 assay. In brief, the medium in each well was replaced with 110 μl of CCK-8 solution for 2 h. Then, all the samples were transferred to a 96-well plate. The absorbance was determined by a microplate reader (Infinite M200, TECAN) at a wavelength of 450 nm.

2.7. Cell Proliferation Assay

NSCs were seeded on the surface of Matrigel-coated films at a density of in NSC growth medium. Cell proliferation was evaluated at 1, 4, and 7 days by an MTT assay. In brief, the stock solution was added to the medium, followed by the addition of acidified isopropanol after incubation at 37°C for 4 h. A full wavelength microplate reader (Infinite M200, TECAN) was used to observe the optical density (OD) at a wavelength of 540 nm in each well.

2.8. Cell Differentiation Assay

After NSCs were cultured in growth medium for two days, and then, the growth medium was removed and replaced to differentiation medium. Cell differentiation assay included immunofluorescence staining and real-time PCR, which was performed after cell cultured for 7 d. For immunofluorescence staining, the cells were fixed with 4% paraformaldehyde for 30 min, extracted with 0.1% Triton X-100 for 10 min, and blocked with 5% goat serum for 2 h. Then, primary antibodies including tuj-1 (1 : 300 dilution) and GFAP (1 : 500 dilution) were added followed by incubation. The staining result was obtained by a laser scanning microscope (LSM 780, ZEISS). For RT-PCR, after the total RNA purity was according with the standard for following procedure, reverse-transcription and amplification were performed., followed by normalized to housekeeping gene. The genes and the primer sequences are shown in Table 1.


GenePrimer sequence (5-3)

Tuj-1F GATCGGAGCCAAGTTCTG; R GTCCATCGTCCCAGGTTC
GFAPF GCACTCAATACGAGGCAGTG; R GGCGATAGTCGTTAGCTTCG
GAPDHF TCGCCAGCCGAGCCA; R CCTTGACGGTGCCATGGAAT

2.9. Statistical Analysis

All quantitative data was analysed with OriginPro 8.0, which presented as the mean ± standard deviation. Statistical differences were analysed by one-way analysis of variance. A value of was considered statistically significant.

3. Results and Discussion

3.1. Characterization of the GO-TH Hybrid

The microstructure of the prepared material was observed by TEM, as shown in Figure 1(a). GO exhibited a natural stretch, showing a flaky and pleated pattern that is similar to a flaking pleated sheet. After grafting L-theanine, the surface roughness of the GO-TH hybrid significantly increased, and the amino acid molecules were observed on the surface. This morphological change may be caused by the grafting of amino acids onto the surface of the GO. This rough surface may contribute to the enhancement of the material’s adsorption capacity [20, 21]. FTIR was employed to confirm the interaction between GO and L-theanine. As shown in Figure 1(b), for the spectra of GO, the peaks at 1052 cm-1, 1730 cm-1, and 3417 cm-1 are attributed to the C—O band, C=O stretching band, and O—H stretching band of carboxylic acid and hydroxy groups, respectively. For the spectra of GO-TH, the C=O stretching of the amide and carboxylate groups in the range of 1620-1630 cm-1 and the O—H and N—H stretching peaks at 3420 cm-1 confirmed the successful covalent functionalization of GO by the amino acid molecules. XRD was used to determine GO and the GO–TH hybrid. As shown in Figure 1(c), the single diffraction peak at 2θ was 11.6°, and the interlayer distance was 0.76 nm in the GO group, which indicated the oxygen-containing functional groups of GO. Compare with GO, GO–TH show two XRD peaks with a similar XRD. Due to the introduction of L-theanine, GO-TH showed a diffraction peak at 2θ =10.4°, corresponding to a d-spacing of 0.99 nm. The large interlayer distance may be attributed to the TH molecules that are inserted between the neighboring GO sheets in the GO–TH membranes.

3.2. Properties of Composite Film

The hydrophilicity and mechanical properties of composite materials play an essential role in cell interactions with the substrate [2224]. In this study, the contact angle and tensile strength of the composite film were evaluated, as shown in Figures 2 and 3. We found the contact angles of the PLGA/GO and PLGA/GO-TH samples were significantly lower than those of the PLGA sample, indicating that GO and GO-TH addition to PLGA can enhance its hydrophilicity (, Figure 2). There are a large number of hydrophilic groups on GO surface, such as OH, CAOAC, and COOH, which can greatly improve the hydrophilicity of hydrophobic materials. The decrease in contact angle can be explained by the hydrogen bond interaction between GO and the oxygen-containing groups in the water [25]. Furthermore, GO can improve the roughness of the material surface to some extent, which can also improve the hydrophilicity of the material [26]. More importantly, L-theanine is a hydrophilic amino acid, and its presence on the material surface may also improve the material’s hydrophilicity to some extent [19]. The improved hydrophilic properties of biomaterials can promote cell adhesion and growth. Next, the mechanical strength of different composite films was measured. Our results showed that the tensile strengths of the PLGA film were significantly lower than that of PLGA/GO and PLGA/GO-TH (, Figure 3). Studies showed better mechanical properties could enhance the stability of neural scaffolds [23, 24]. Because of the interfacial interaction between the oxygen-containing functional portion of GO and the hydroxyl or amino groups of the substrate, the mechanical properties of composite films are better than pure PLGA films [27].

3.3. Lysozyme Adsorption Capacity of the PLGA/GO-TH Film

In this study, lysozyme was used as a model protein to study the adsorption capacity of composite materials for proteins. The results showed that after 120 min, the PLGA/GO film had significantly more protein adsorption than the pure PLGA film (, Figure 4), possibly because of GO binding to proteins through hydrogen bonding and ππ interactions [28, 29]. We also found that the protein adsorption capacity of the PLGA/GO-TH film was higher than that of the PLGA/GO film. Combined with the results of the TEM observation, we suspected that the modification of GO with L-theanine roughened the surface of GO; this modification could be beneficial to protein absorption. Moreover, the isoelectric point is believed to play an important role in protein absorption. Studies have demonstrated that electrostatic attraction makes a larger contribution to the kinetic adsorption of proteins than hydrogen bonding and ππ interactions [30]. In our study, PBS solution () was selected to dissolve lysozyme. The isoelectric point of L-theanine is 5.6, which increases the negative charge on the modified GO surface, while the isoelectric point of lysozyme is 10.5 and thus is positively charged in PBS. The attraction between the positive and negative charges eventually leads to a better protein adsorption effect on the PLGA/GO-TH film. The isoelectric points of commonly used nerve-related growth factors, such as IGF, BDNF, and bFGF, are between 9 and 10, which also suggests that PLGA/GO-TH composite materials have the potential to act as a carrier to adsorb nerve-related growth factors to further strengthen its nerve repair effects.

3.4. Cell Survival Rate

Central nervous system damage will cause reactive oxygen species (ROS) overload, and the subsequent oxidative stress reaction will further cause increased cell death in the injured area, which is the main reason for the failure of nerve repair after injury [31, 32]. Therefore, the neuroprotective effects of implanted materials against oxidative stress are one of the indicators for the evaluation of their potential for neural application. To verify whether the composites can provide neuroprotective effects on surface-grown NSCs, we observed the survival rate of NSCs on the surface of each group after H2O2 treatment. The results showed that there was no significant difference in the survival rate of NSCs in the glass, PLGA, and PLGA/GO groups. Although there was no significant difference between the PLGA/GO-TH, glass, and PLGA/GO groups, the survival rate of the PLGA/GO-TH group was significantly higher than that of the PLGA group (, Figure 5).

It was found that L-theanine can upregulate the expression of the antiapoptotic protein Bcl-2 and decrease the level of caspase-3 by through inhibition of the ERK and JNK pathways, thereby reversing the large amount of ROS produced by mitochondrial dysfunction [33, 34]. Central nervous system damage will cause reactive oxygen species (ROS) overload, and the subsequent oxidative stress reaction will further cause apoptosis and cell death. The mechanism of the antioxidant effect of L-theanine was mainly related to reversing the ROS overload [35, 36]. Furthermore, studies have confirmed that L-theanine also plays a positive role in the fight against oxidative stress in various cells, such as hepatocytes, neurons, and cardiomyocytes [34, 37]. In the present study, H2O2 was used to establish the oxidative damage cell microenvironment, and the survival of NSCs on different materials was observed. The results showed that there was no significant difference between the PLGA group and the PLGA/GO group, indicating that the addition of GO alone did not improve the survival rate of NSCs. The survival rate of NSCs in the PLGA/GO-TH group was significantly higher than that in the PLGA group, indicating that the addition of L-theanine on the composite film effectively increased the survival rate of NSCs, which further confirmed that L-theanine not only can resist neurons and cardiomyocytes but also had an antioxidant neuroprotective function in NSCs; this outcome further provides a basis for the in vivo application of PLGA/GO-TH composite film in nerve injury. In addition, our results suggested that there was no significant difference between the survival rates of the PLGA/GO-TH and PLGA/GO groups. A previous study indicated that the antioxidative effects of L-theanine on NSCs may be dose-dependent [37]. Therefore, we speculated that the amount of L-theanine grafting on the surface of the modified GO may be limited, which may not be sufficient for the NSCs to effectively survive under H2O2 treatment.

3.5. Proliferation of NSCs on the PLGA/GO-TH Film

We found the cell proliferation in different composite film groups and a glass group as a control on days 1, 4, and 7. As shown in Figure 6, the results showed no significant difference in the OD values of the 4 groups on the first day. The OD values of the PLGA/GO-TH and PLGA/GO group were significantly higher than those of the other two groups on the 4th day. The OD values of the PLGA/GO-TH group were the highest among the four groups at 7 days (, Figure 6). There was no significant difference between the OD values of the glass and PLGA groups on the 7th day, both of which were significantly lower than that in the PLGA/GO and PLGA/GO-TH groups.

Our results show that the proliferation of NSCs on the surface of the PLGA film was lower than that on the composite films containing GO, possibly because PLGA itself is hydrophobic and not conducive to the adhesion of NSCs [38]. After the addition of GO, the hydrophilicity of the GO-based material was obviously improved, subsequently promoting the adhesion and growth of cells. Moreover, GO can adsorb proteins or cells through its specific chemical groups and hydrogen bonds; although, the proliferative effect of GO was not obvious over a short time based on our results. However, on the 4th and 7th day, the composite material mixed with GO still promoted NSC more proliferation than the pure PLGA material. We also found that the number of NSCs grown on the PLGA/GO-TH composite film was significantly higher than that on the PLGA/GO composite film on the 4th and 7th days. Amino acids are the basic substances for constituting proteins and are also well-known for ensuring the normal physiological activities of organisms, and playing a specific role in cell adhesion, proliferation, and differentiation [3941]. Current studies have found that some amino acids can promote the proliferation of NSCs, such as serine and glutamate [42, 43]. L-Theanine is considered safe for humans as no toxic effects have been reported so far, though the regulation for its ingestion varies among countries. Because l-theanine is the precursor of glutamate, it can be used as an additional source of glutamate in the body, which can be integrated into the cytoplasm and stimulate the glycolysis process of cells and tissues [44]. This is one reason why l-theanine can improve cell proliferation. The results of this study further confirmed the proliferative effects of the PLGA/GO-TH composite film on NSCs and indicated that the introduction of L-theanine could have a positive effect on the proliferation of NSCs; these results are consistent with those from the previous study [17].

3.6. Differentiation of NSCs on the PLGA/GO-TH Film

To further explore the effect of PLGA/GO-TH composite film on the differentiation of NSCs, tuj-1 was selected as a specific expression gene of neurons, and GFAP was selected as a specific expression gene of astrocytes, which underwent quantitative and qualitative analysis using PCR and immunofluorescence, respectively. The PCR results showed that there was no significant difference in the expression level of tuj-1 between the glass control group and the PLGA group, both of which were significantly lower than that of the PLGA/GO group. The expression of tuj-1 in the PLGA/GO-TH group was higher than that in the rest groups (, Figure 7(a)). The GFAP expression levels in the glass control group and the PLGA group were significantly higher than those in the PLGA/GO and PLGA/GO-TH groups (, Figure 7(b)), and there was no significant difference in GFAP expression between the PLGA/GO group and the PLGA/GO-TH group. As shown is Figure 8, the immunofluorescence analysis showed that the neurons and astrocytes derived from cultured NSCs spread on the surface of different materials, and the change in the trend of the number of positive cells in each group was basically corresponding to the PCR results.

Our results indicated GO composites have a positive effect on the neuronal differentiation of NSCs, which is consistent with previous studies [8, 9]. Studies have shown that GO-based materials have electrical properties related to ion channel opening and signal transmission between neurons, so they can spontaneously initiate neuronal activity [45, 46]. Considering that the physiological activities of neurons are closely related to bioelectricity, GO-based composite biomaterials have unique advantages in the field of neural tissue engineering. Some studies have suggested that the unique structure of GO nanocomposites increases the contact and communication between cells and the interaction between cells and matrix materials, which may also have a positive effect on the growth and neuronal differentiation of NSCs [47]. After the modification of GO by L-theanine, we found that the new PLGA/GO-TH composite film further promotes the differentiation of NSCs into neurons. A previous study demonstrated that L-theanine can effectively induce NSCs to differentiate into neurons and relatively inhibit their differentiation into astrocytes, which may be due to the upregulation of Slc38a1 gene expression by L-theanine to activate the mTOR signalling pathway [17]. This study further demonstrated that the GO-based composite film after the grafting of L-theanine facilitated NSC neuronal differentiation. For central nervous system injury, NSCs should be induced to differentiate into neurons as much as possible while avoiding their differentiation into astrocytes [4850]. How to find a solution to induce the NSC neuronal differentiation rate in the injured site has always been a problem in the process of nerve repair, and the PLGA/GO-TH composite materials produced in this study will create a new way to solve this problem. However, the long-term effects of PLGA/GO-TH composite materials in the organism should be taken into account when they were applied in nerve repair. The degradation product of PLGA is acidic, which may cause an inflammatory response in the surrounding tissues. Furthermore, the optimum range of water contact angles for cell culture substrates is between 5° and 40°, and the proliferation rate of cells can be improved if they grow on the materials with such a water contact angle. The hydrophilicity of PLGA/GO-TH composite materials is still relatively limited and therefore cannot maximize cell adhesion and proliferation. In the future work, we will further study and solve these problems.

4. Conclusion

In summary, we first successfully synthesized a PLGA/GO-TH composite film and then determined its characterization. We found that the PLGA/GO-TH composite film had a satisfactory physical property and protein adsorption capability. Furthermore, our results indicated that the PLGA/GO-TH composite film can effectively enhance the survival of NSCs in the oxidative damage environment and have a clear promotion effect on the cell proliferation and neuron differentiation. However, the present study only focused on cell experiments. The application of the PLGA/GO-TH material in vivo should be further evaluated. In addition, the molecular mechanism of PLGA/GO-TH promotion of the proliferation and differentiation of NSCs into neurons should also be explored. Our findings revealed that the novel modified composite biomaterial PLGA/GO-TH has great potential as a candidate implant for nerve repair.

Data Availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

There are no conflicts of interest to declare.

Acknowledgments

This study was supported by the Jilin Province Medical Talent Project, 2019SRCJ019; the Natural Science Foundation of Jilin Province, 20200201454JC and 20200201446JC.

References

  1. S. Wu, K. T. FitzGerald, and J. Giordano, “On the viability and potential value of stem cells for repair and treatment of central neurotrauma: overview and speculations,” Frontiers in Neurology, vol. 9, p. 602, 2018. View at: Publisher Site | Google Scholar
  2. J. Wang, Y. Cheng, L. Chen et al., “In vitro and in vivo studies of electroactive reduced graphene oxide-modified nanofiber scaffolds for peripheral nerve regeneration,” Acta Biomaterialia, vol. 84, pp. 98–113, 2019. View at: Publisher Site | Google Scholar
  3. Z. Zhang, L. H. Klausen, M. Chen, and M. Dong, “Electroactive Scaffolds for Neurogenesis and Myogenesis: Graphene-Based Nanomaterials,” Small, vol. 14, no. 48, article e1801983, 2018. View at: Publisher Site | Google Scholar
  4. D. Convertino, S. Luin, L. Marchetti, and C. Coletti, “Peripheral neuron survival and outgrowth on graphene,” Frontiers in Neuroscience, vol. 12, p. 1, 2018. View at: Publisher Site | Google Scholar
  5. J. S. Lee, A. Lipatov, L. Ha et al., “Graphene substrate for inducing neurite outgrowth,” Biochemical and Biophysical Research Communications, vol. 460, no. 2, pp. 267–273, 2015. View at: Publisher Site | Google Scholar
  6. C. Fu, X. Yang, S. Tan, and L. Song, “Enhancing Cell Proliferation and Osteogenic Differentiation of MC3T3-E1 Pre- osteoblasts by BMP-2 Delivery in Graphene Oxide-Incorporated PLGA/HA Biodegradable Microcarriers,” Scientific Reports, vol. 7, no. 1, article 12549, 2017. View at: Publisher Site | Google Scholar
  7. E. Lopez-Dolado, A. Gonzalez-Mayorga, M. C. Gutierrez, and M. C. Serrano, “Immunomodulatory and angiogenic responses induced by graphene oxide scaffolds in chronic spinal hemisected rats,” Biomaterials, vol. 99, pp. 72–81, 2016. View at: Publisher Site | Google Scholar
  8. D. Yang, T. Li, M. Xu et al., “Graphene oxide promotes the differentiation of mouse embryonic stem cells to dopamine neurons,” Nanomedicine, vol. 9, no. 16, pp. 2445–2455, 2014. View at: Publisher Site | Google Scholar
  9. S. Shah, P. T. Yin, T. M. Uehara, S. T. Chueng, L. Yang, and K. B. Lee, “Guiding stem cell differentiation into oligodendrocytes using graphene-nanofiber hybrid scaffolds,” Advanced Materials, vol. 26, no. 22, pp. 3673–3680, 2014. View at: Publisher Site | Google Scholar
  10. E. C. Das, S. Dhawan, J. Babu et al., “Self-assembling polymeric dendritic peptide as functional osteogenic matrix for periodontal regeneration scaffolds-an in vitro study,” Journal of Periodontal Research, vol. 54, no. 5, pp. 468–480, 2019. View at: Publisher Site | Google Scholar
  11. W. H. Lee, C. Y. Loo, K. L. Van, A. V. Zavgorodniy, and R. Rohanizadeh, “Modulating protein adsorption onto hydroxyapatite particles using different amino acid treatments,” Journal of The Royal Society Interface, vol. 9, no. 70, pp. 918–927, 2011. View at: Publisher Site | Google Scholar
  12. I. S. Moreira, P. A. Fernandes, and M. J. Ramos, “Hot spots-A review of the protein-protein interface determinant amino-acid residues,” Proteins, vol. 68, no. 4, pp. 803–812, 2007. View at: Publisher Site | Google Scholar
  13. J. Li, S. Wang, D. Zhang, and X. Ni, “Amino acids functionalized graphene oxide for enhanced hydrophilicity and antifouling property of poly(vinylidene fluoride) membranes,” Chinese Journal of Polymer Science, vol. 34, no. 7, pp. 805–819, 2016. View at: Publisher Site | Google Scholar
  14. M. Zukhurova, M. Prosvirnina, A. Daineko et al., “L-theanine administration results in neuroprotection and prevents glutamate receptor agonist-mediated injury in the rat model of cerebral ischemia-reperfusion,” Phytotherapy Research, vol. 27, no. 9, pp. 1282–1287, 2013. View at: Publisher Site | Google Scholar
  15. T. I. Kim, Y. K. Lee, S. G. Park et al., “l-Theanine, an amino acid in green tea, attenuates beta-amyloid-induced cognitive dysfunction and neurotoxicity: reduction in oxidative damage and inactivation of ERK/p38 kinase and NF-kappaB pathways,” Free Radical Biology & Medicine, vol. 47, no. 11, pp. 1601–1610, 2009. View at: Publisher Site | Google Scholar
  16. S. Jamwal, S. Singh, J. S. Gill, and P. Kumar, “L-theanine prevent quinolinic acid induced motor deficit and striatal neurotoxicity: reduction in oxido-nitrosative stress and restoration of striatal neurotransmitters level,” European Journal of Pharmacology, vol. 811, pp. 171–179, 2017. View at: Publisher Site | Google Scholar
  17. T. Takarada, M. Ogura, N. Nakamichi et al., “Upregulation of Slc38a1 gene along with promotion of neurosphere growth and subsequent neuronal specification in undifferentiated neural progenitor cells exposed to theanine,” Neurochemical Research, vol. 41, no. 1-2, pp. 5–15, 2016. View at: Publisher Site | Google Scholar
  18. O. J. Yoon, C. Y. Jung, I. Y. Sohn et al., “Nanocomposite nanofibers of poly(D, L-lactic-co-glycolic acid) and graphene oxide nanosheets,” Composites Part a-Applied Science And Manufacturing, vol. 42, no. 12, pp. 1978–1984, 2011. View at: Publisher Site | Google Scholar
  19. S. Pan, Z. Qi, Q. Li et al., “Graphene oxide-PLGA hybrid nanofibres for the local delivery of IGF-1 and BDNF in spinal cord repair,” Artificial Cells, Nanomedicine, and Biotechnology, vol. 47, no. 1, pp. 651–664, 2019. View at: Publisher Site | Google Scholar
  20. D. Yamashita, M. Machigashira, M. Miyamoto et al., “Effect of surface roughness on initial responses of osteoblast-like cells on two types of zirconia,” Dental Materials Journal, vol. 28, no. 4, pp. 461–470, 2009. View at: Publisher Site | Google Scholar
  21. A. Zareidoost, M. Yousefpour, B. Ghaseme, and A. Amanzadeh, “The relationship of surface roughness and cell response of chemical surface modification of titanium,” Journal of Materials Science. Materials in Medicine, vol. 23, no. 6, pp. 1479–1488, 2012. View at: Publisher Site | Google Scholar
  22. M. Salehi, S. Farzamfar, S. Bozorgzadeh, and F. Bastami, “Fabrication of poly(L-lactic acid)/chitosan scaffolds by solid-liquid phase separation method for nerve tissue engineering: an in vitro study on human neuroblasts,” The Journal of Craniofacial Surgery, vol. 30, no. 3, pp. 784–789, 2019. View at: Publisher Site | Google Scholar
  23. J. Shang, H. Qiao, P. Hao et al., “bFGF-sodium hyaluronate collagen scaffolds enable the formation of nascent neural networks after adult spinal cord injury,” Journal of Biomedical Nanotechnology, vol. 15, no. 4, pp. 703–716, 2019. View at: Publisher Site | Google Scholar
  24. C. Chen, M. L. Zhao, R. K. Zhang et al., “Collagen/heparin sulfate scaffolds fabricated by a 3D bioprinter improved mechanical properties and neurological function after spinal cord injury in rats,” Journal of Biomedical Materials Research. Part A, vol. 105, no. 5, pp. 1324–1332, 2017. View at: Publisher Site | Google Scholar
  25. K. Zhang, H. Zheng, S. Liang, and C. Gao, “Aligned PLLA nanofibrous scaffolds coated with graphene oxide for promoting neural cell growth,” Acta Biomaterialia, vol. 37, pp. 131–142, 2016. View at: Publisher Site | Google Scholar
  26. H. Belaid, S. Nagarajan, C. Teyssier et al., “Development of new biocompatible 3D printed graphene oxide-based scaffolds,” Materials Science and Engineering: C, vol. 110, p. 110595, 2020. View at: Publisher Site | Google Scholar
  27. M. Yuan, C. Xiong, L. Jiang, H. Li, and M. Yuan, “The Preparation, Characterization, Mechanical and Antibacterial Properties of GO-ZnO Nanocomposites with a Poly(l-lactide)-Modified Surface,” Materials, vol. 11, no. 2, p. 323, 2018. View at: Publisher Site | Google Scholar
  28. Z. Xu, X. Lei, Y. Tu, Z. J. Tan, B. Song, and H. Fang, “Dynamic cooperation of hydrogen binding and π stacking in ssDNA adsorption on graphene oxide,” Chemistry, vol. 23, no. 53, pp. 13100–13104, 2017. View at: Publisher Site | Google Scholar
  29. H. Li, K. Fierens, Z. Zhang et al., “Spontaneous protein adsorption on Graphene oxide Nanosheets allowing efficient intracellular vaccine protein delivery,” ACS Applied Materials & Interfaces, vol. 8, no. 2, pp. 1147–1155, 2016. View at: Publisher Site | Google Scholar
  30. M. Yan, Q. Liang, W. Wan, and Q. Han, “Amino acid-modified graphene oxide magnetic nanocomposite for the magnetic separation of proteins,” RSC Advances, vol. 7, no. 48, pp. 30109–30117, 2017. View at: Publisher Site | Google Scholar
  31. C. S. Ahuja, S. Nori, L. Tetreault et al., “Traumatic spinal cord injury-repair and regeneration,” Neurosurgery, vol. 80, no. 3S, pp. S9–S22, 2017. View at: Publisher Site | Google Scholar
  32. E. D. Hall, J. A. Wang, D. M. Miller, J. E. Cebak, and R. L. Hill, “Newer pharmacological approaches for antioxidant neuroprotection in traumatic brain injury,” Neuropharmacology, vol. 145, Part B, pp. 247–258, 2019. View at: Publisher Site | Google Scholar
  33. P. Ben, Z. Zhang, C. Xuan et al., “Protective effect of L-theanine on cadmium-induced apoptosis in PC12 cells by inhibiting the mitochondria-mediated pathway,” Neurochemical Research, vol. 40, no. 8, pp. 1661–1670, 2015. View at: Publisher Site | Google Scholar
  34. Z. Gong, Q. Liu, L. Lin et al., “l-Theanine prevents ETEC-induced liver damage by reducing intrinsic apoptotic response and inhibiting ERK1/2 and JNK1/2 signaling pathways,” European Journal of Pharmacology, vol. 818, pp. 184–190, 2018. View at: Publisher Site | Google Scholar
  35. G. Li, Y. Ye, J. Kang et al., “l-Theanine prevents alcoholic liver injury through enhancing the antioxidant capability of hepatocytes,” Food and Chemical Toxicology, vol. 50, no. 2, pp. 363–372, 2012. View at: Publisher Site | Google Scholar
  36. C. Li, Q. Yan, S. Tang, W. Xiao, and Z. Tan, “L-Theanine protects H9C2 cells from hydrogen peroxide-induced apoptosis by enhancing antioxidant capability,” Medical Science Monitor, vol. 24, pp. 2109–2118, 2018. View at: Publisher Site | Google Scholar
  37. H. S. Cho, S. Kim, S. Y. Lee, J. A. Park, S. J. Kim, and H. S. Chun, “Protective effect of the green tea component, L-theanine on environmental toxins-induced neuronal cell death,” Neurotoxicology, vol. 29, no. 4, pp. 656–662, 2008. View at: Publisher Site | Google Scholar
  38. E. W. C. Chan, D. Bennet, P. Baek, D. Barker, S. Kim, and J. Travas-Sejdic, “Electrospun Polythiophene Phenylenes for tissue engineering,” Biomacromolecules, vol. 19, no. 5, pp. 1456–1468, 2018. View at: Publisher Site | Google Scholar
  39. H. Shi, X. Ye, F. He, and J. Ye, “Improving osteogenesis of calcium phosphate bone cement by incorporating with lysine: an in vitro study,” Colloids and Surfaces. B, Biointerfaces, vol. 177, pp. 462–469, 2019. View at: Publisher Site | Google Scholar
  40. M. S. Niepel, B. K. Ekambaram, C. E. H. Schmelzer, and T. Groth, “Polyelectrolyte multilayers of poly (l-lysine) and hyaluronic acid on nanostructured surfaces affect stem cell response,” Nanoscale, vol. 11, no. 6, pp. 2878–2891, 2019. View at: Publisher Site | Google Scholar
  41. C. L. Jin, Z. M. Zhang, J. L. Ye et al., “Lysine-induced swine satellite cell migration is mediated by the FAK pathway,” Food & Function, vol. 10, no. 2, pp. 583–591, 2019. View at: Publisher Site | Google Scholar
  42. X. Huang, H. Kong, M. Tang, M. Lu, J. H. Ding, and G. Hu, “D-Serine regulates proliferation and neuronal differentiation of neural stem cells from postnatal mouse forebrain,” CNS Neuroscience & Therapeutics, vol. 18, no. 1, pp. 4–13, 2012. View at: Publisher Site | Google Scholar
  43. C. X. Liu, X. Xu, X. L. Chen, P. B. Yang, J. S. Zhang, and Y. Liu, “Glutamate promotes neural stem cell proliferation by increasing the expression of vascular endothelial growth factor of astrocytes in vitro,” Cellular and Molecular Biology, vol. 61, no. 4, pp. 75–84, 2015. View at: Google Scholar
  44. T. R. Dias, R. L. Bernardino, M. G. Alves et al., “L-Theanine promotes cultured human Sertoli cells proliferation and modulates glucose metabolism,” European Journal of Nutrition, vol. 58, no. 7, pp. 2961–2970, 2019. View at: Publisher Site | Google Scholar
  45. C. Heo, J. Yoo, S. Lee et al., “The control of neural cell-to-cell interactions through non-contact electrical field stimulation using graphene electrodes,” Biomaterials, vol. 32, no. 1, pp. 19–27, 2011. View at: Publisher Site | Google Scholar
  46. S. Y. Park, J. Park, S. H. Sim et al., “Enhanced differentiation of human neural stem cells into neurons on graphene,” Advanced Materials, vol. 23, no. 36, pp. H263–H267, 2011. View at: Publisher Site | Google Scholar
  47. W. Kenry, C. Lee, K. P. Loh, and C. T. Lim, “When stem cells meet graphene: opportunities and challenges in regenerative medicine,” Biomaterials, vol. 155, pp. 236–250, 2018. View at: Publisher Site | Google Scholar
  48. X. Li, J. Han, Y. Zhao et al., “Functionalized collagen scaffold neutralizing the myelin-inhibitory molecules promoted neurites outgrowth in vitro and facilitated spinal cord regeneration in vivo,” ACS Applied Materials & Interfaces, vol. 7, no. 25, pp. 13960–13971, 2015. View at: Publisher Site | Google Scholar
  49. X. Li, Z. Xiao, J. Han et al., “Promotion of neuronal differentiation of neural progenitor cells by using EGFR antibody functionalized collagen scaffolds for spinal cord injury repair,” Biomaterials, vol. 34, no. 21, pp. 5107–5116, 2013. View at: Publisher Site | Google Scholar
  50. D. Macaya and M. Spector, “Injectable hydrogel materials for spinal cord regeneration: a review,” Biomedical Materials, vol. 7, no. 1, article 012001, 2012. View at: Google Scholar

Copyright © 2020 Zhiping Qi et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views312
Downloads281
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.