Journal of Nutrition and Metabolism / 2011 / Article / Tab 1

Research Article

Unique Mode of Lipogenic Activation in Rat Preputial Sebocytes

Table 1

Primers for RT-PCR.

Primer sequence
PrimerForward (5′ to 3′)Reverse (5′-3′)

ACAT-15′-ATGGCTGCCCTGGCGGTTCTA-3′5′-CTACAGCTTCTCAATCAGCAC-3′
Add-15′-ATGGATTGCACATTTGAAGAC-3′5′-TGGTACTGTGGCCAGGATGGT-3′
Adipsin5′-ATGCACAGCTCCGTGTACCTC-3′5′-TCAGGCCGTCACGTTAACACT-3′
aP25′-TGGAAACTCGTCTCCAGTGAG-3′5′-CAAATTTCAGTCCAGGGCCTC-3′
Apo-E5′-ATGAAGGCTCTGTGGGCCCTG-3′5′-TCATTGATTTCTCCAGGGCAC-3′
CD365′-GCAGCTGCACCACATATCTAC-3′5′-GCTGGCTTGACCAGTATGTTG-3′
DGAT-15′-GCGGTTTCAGCAATTACCGTG-3′5′-ACTGGGGCATCATAGTTGAGC-3′
HSL5′GAAACCTAGGAGACCAATTTC-3′5′-ACCTGCAAAGACGTTGGACAG-3′
Leptin5′-ATGACATTTCACACACGCAGT-3′5′-CTAGAGGAGTAGGAGAAACGG -3′
Leptin-R5′-ATGACGTGTCAGAAATTCTATG-3′5′-GGAAGCATTGGATCCAACACT-3′
LPL5′-ATGGAGAGCAAAGCCCTGCTC-3′5′-CAGAGACTTGTCATGGCATTT-3′
MC5-R5′- ATGAACTCCTCGTCTCACCTG -3′5′- TTAATACCTGCCAAGGAGCGT -3′
Scd-15′-ATGCCGGCCCACATGCTCCAA-3′5′-TCAGCTACTCTTGTGGCTCCC-3′
SR-B15′-ATCATGATTCTCATGGTGCCC-3′5′-TGGCAGCTGGTGACATCAGAG-3′

acyl-CoA:cholesterol acyltransferase type 1 (ACAT-1), adipocyte determination factor (Add-1), adipocyte fatty acid binding protein (aP2), apolipoprotein E (ApoE), fatty acid translocase (CD-36), acyl-CoA:diacylglycerol acyltransferase type 1 (DGAT1), hormone sensitive lipase (HSL), leptin receptor (Leptin-R), lipoprotein lipase (LPL), melanocortin 5 receptor (MC5-R), stearoyl-CoA desaturase type 1 (Scd-1), and scavenger receptor type BI (SR-B1).

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.