Journal of Oncology / 2010 / Article / Tab 1

Research Article

Lack of a Y-Chromosomal Complement in the Majority of Gestational Trophoblastic Neoplasms

Table 1

The primer sequences used to amplify the PRK and ZF loci.

Primer NameSequence

PRK-F 5 FAM-TTTTGTTTCTTTCTGTCCATACTTAAAG 3
PRK-R 5 TCCCAAACCACTCAACTG 3
ZF-F 5 FAM-TGTGCATAACTTTGTTCCTGATG 3
ZF-R 5 AGCACTTGCTCAGGAATGATG 3

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.