Table 2: Mutational profile of AML#2 at diagnosis and relapse.

PtGeneLocusNM_IDExonTypeCodingAmino acid changeVAF (%)Variant effect

AML#2DxDNMT3Achr2:25458586NM_022552.422INDELc.2586_2587insp.Glu863Ser35.79Nonsense
TET2chr4:106155491NM_001127208.23INDELc.395delAp.Asn132fs38.55fs del
TET2chr4:106197168NM_001127208.211INDELc.5504delGp.Gly1835fs43.60fs del
NPM1chr5:170837545NM_002520.611INDELc.863_864insCTTGp.Trp288fs37.41fs ins
FLT3chr13:28608308NM_004119.214INDELc.1747_1748insp.Gly583_Ser584ins11.70Nonfs ins
AML#2RDNMT3Achr2:25458586NM_022552.422INDELc.2586_2587insp.Glu863Ser42.45Nonsense
TET2chr4:106155491NM_001127208.23INDELc.395delAp.Asn132fs48.34fs del
TET2chr4:106197168NM_001127208.211INDELc.5504delGp.Gly1835fs49.65fs del
NPM1chr5:170837545NM_002520.611INDELc.863_864insCTTGp.Trp288fs42.87fs ins
WT1chr11:32417943NM_024426.47SNVc.1109G > Cp.Arg370Pro48.25Missense
FLT3chr13:28608308NM_004119.214INDELc.1747_1748insp.Gly583_Ser584ins40.10Nonfs ins

Pt: patient; Dx: diagnosis; R: relapse; SNV: single-nucleotide variant; INDEL: insertion/deletion; ins: insertion; fs: frameshift; del: deletion; insertion of 35 nucleotides: TCATGAATGAGAAAGAGGACATCTTATGGTGCAC; insertion of 57 nucelotides: GCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCCA; SerSerAspAsnGluTyrPheTyrValAspPheArgGluTyrGluTyrAspProSer.