Journal of Obesity / 2010 / Article / Tab 1

Research Article

Body Weight Control by a High-Carbohydrate/Low-Fat Diet Slows the Progression of Diabetic Kidney Damage in an Obese, Hypertensive, Type 2 Diabetic Rat Model

Table 1

Primers for real-time PCR.

GeneForward primer (5 to 3)Reverse primer (5 to 3)

TGF-betaTGCGCCTGCAGAGATTCAAGAGGTAACGCCAGGAATTGTTGCTA
CTGFCACCCGGGTTACCAATGACAAAGCCCGGTAGGTCTTCACACTG
PAI-1GCCCAGCATTCAGCCTTTGAAGACTTTGCTGAGTGAAGGCGTAG
Nox2CGGGACTTCGGACCCATATTCATTCCTGTGATGCCAGCCAAC
47phoxCCACGGGTATTGCTAGGATGAGAAGACTAAGGCAGCGGGTAATCAGA
TNF-alphaAACTCGAGTGACAAGCCCGTAGGTACCACCAGTTGGTTGTCTTTGA
ICAM-1ACAAGTGCCGTGCCTTTAGCTCGATCACGAAGCCCGCAATG
VCAM-1GGATGCCGGAGTATACGAGTGTGCAATGGCGGGTATTACCAAGGA
GAPDHGACAACTTTGGCATCGTGGAATGCAGGGATGATGTTCTGG

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.