Journal of Ophthalmology / 2009 / Article / Tab 2

Clinical Study

Association of Lumican Gene with Susceptibility to Pathological Myopia in the Northern Han Ethnic Chinese

Table 2

The primer sequence and the product length in the PCR analysis.

GeneFragment namePrimer sequence ( 5 - 3 )Length (bp)

lumicanRs3759223F:AAATATGCTCTGAAACGCACAA250
R:AACAATGCTATGTATTAATTTTGAGTG
Exon 2F:TGTTGCAAATTGAATGTCTTTTTC992
R:GAGCACACATCAAACACAGGA
Exon 3aF: ACAACAATGGGATCCATTTATATTTC585
R:TATGGATACTATGAAAACTGACACACA
Exon 3bF: CCGGATATGTATGAATGTCTACG495
R: TTGCAATATTCTTGGCCTCA
decorinExon 7F:GAAAGGCATCCATGTGTGGT239
R:CTTCCCAGCATCCCATAAGC
Exon 8aF: ACCTGAAGGGCCTCAACATA622
R: TGCTCAATGAATTACAGAAGACTCA
Exon 8bF: GGAGTAAATATATATGTC584
R: CTTACGTCTAATACATCTAG

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.