Table 4: Novel truncating and nonsense EYS mutations found in this study.

Mutation DNA variantProtein variantDiagnosis

1c.179delTp.L60W fs*3RP
2IVS27-3_4insTRP
3IVS38-1G>TRP
4c.2380C>Tp.R794*RP
5c.4557delAp.A1520P fs*30RP
6c.5202_5203delGTp.F1735Q fs*6RP
7c.6869_6896delCCATATTCCTGCAAATGTTCAAATTGATAAGAAAG p.P2290Q fs*12RP
8c.6897_6902dupAGGTCCp.G2300_P2301dupRP
9c.6976C>T p.R2326*RP
10c.7836_7837delTCp.P2613L fs*18RP
11c.8196_8200delCTTTCp.F2733C fs*33RP
12c.8439_8442dupTGCA p.E2815C fs*19RP
13c.8921C>Ap.S2974*RP

Truncating and nonsense variants.