Journal of Pathogens / 2014 / Article / Tab 1

Research Article

Isolation of Environmental Bacteria from Surface and Drinking Water in Mafikeng, South Africa, and Characterization Using Their Antibiotic Resistance Profiles

Table 1

Oligonucleotide primers that were used for specific detection of Pseudomonas species.

PrimerOligonucleotide sequence (5′-3′)Target and size (pb)PCR cycling conditions

ECF1 
ECF2
ATGGATGAGCGCTTCCGTG 
TCATCCTTGCCTCCCTG
ecfX, (528)35X 94°C for 45 s 
58°C for45 s 
72°C for 1 m

GyrPA-398 
GyrPA-620
CCTGACCATCCGTCGCCACAAC 
CGCAGCAGGATGCCGACGCC
gyrB, (222)35X 94°C for 45 s 
66°C for45 s 
72°C for 1 m

ETA1 
ETA2
GACAACGCCCTCAGCATCACCAGC 
CGCTGGCCCATTCGCTCCAGCGCT
toxA, (367)35X 94°C for 45 s 
66°C for45 s 
72°C for 1 m

Initial denaturing step of 95°C for 5 min and final strand extension of 72°C for 5 min.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.