Restriction Profiling of 23S Microheterogenic Ribosomal Repeats for Detection and Characterizing of E. coli and Their Clonal, Pathogenic, and Phylogroups

Table 3

Clonal groups based on Hae III (GG/CC) profiles within the candidate microbe using 23S P2₆₈₂.

Virtual digest pattern		Types of Hae III restriction pattern observed amongst 399 rrn sequences of E. coli genomes
F	C	Type I	Type II	Type III	Type IV
1.1	785	Cut site within rrlH of candidate rrn segments
1.2	1042	1984	1984	1984	1984
1.3	1116	x	2163	X	2163
1.4	1217	x	X	2205	2205
1.5	1361	2415	2415	2415	2415
1.6	1445	Cut site within the amplicon (682 bp)
1.7	1907	28	28	28	28
1.8	1984	x	207	X	207
1.9	2161	x	X	249	249
1.10	2205	459	459	459	459
1.11	2415	Fragments obtained for each group
1.12	2839	28 bp, 223 bp, and 431 bp	28 bp, 179 bp, 223 bp, and 252 bp	28 bp, 210 bp, 221 bp, and 223 bp	28 bp, 42 bp, 179 bp, 210 bp, and 223 bp

Primers were designed against the regions flanking the bold restriction sites. F: number of fragments; C: cut sites.
23S P2₆₈₂-FP(+): 5′CCGACCTGCACGAATGGCGT3′ (20 nt).
23S P2₆₈₂-RP(+): 5′CAGTTCTCCAGCGCCCACGG3′ (20 nt).
Forward and reverse primers of 23S P2₆₈₂ lie within domain IV and transition of V-VI of 23S rRNA secondary structure, respectively. First cut sites lie within domain IV whereas the rest lie within domain V.