Research Article
Biomarkers of Oxidative Stress as Indicators of Fungi Environmental Pollution in Balb/c Albino Mice Monitored from South West, Nigeria
Table 1
Primers used for fungi amplification.
| Locus | Primer name | Direction | Sequence | Target region |
| Internal Transcribed Spacer (ITS) | ITS 1 | Forward | 5′TCCGTAGGTGAACCTGCGG3′ | 18S rDNA | ITS 4 | Reverse | 5′TCCTCCGCTTATTGATATGC3′ | Large Ribosomal Unit | LRO5 | Forward | 5′TCCTGAGGGAAACTTCG3′ | LSU | LROR | Reverse | 5′ACCCGCTGAACTTAAGC 3′ |
|
|