Table 1: Nucleotide sequences for Cryptosporidium hominis and parvum for stem SAM-1 LAMP test. Degenerate primers have been underlined and made bold.

TargetPrimer nameSequence (5′-3′)BasesFinal amplicon size

SAM-1F3GAGGATGGGGTGCTCATGG19220 bp
B3CCTTATTAACTATCTCCAGYAG22
FIPGACTTTGCAACAAGYCTTGCCAGCATTTAGCGGGAAAGATG41
BIPATTGGAATAGCAARGCCTTTATCGTCATTATACCCATCTTTCGC44
LFCRCCTGAYCTATCTACTTTAG21
LBCTRTATATTAATACATTTGGCAC23
SFTACACAAKCCAGAAAAGACG20
SBTGTTTGGTRCAGGTTTCATATG20
ProbeCTTGTGTAGCAGATGTTTGGTACAGG
26