Is International Travel an Emerging Issue on Transmission of Beijing Lineage Mycobacterium tuberculosis?

Box 1

PCR amplification steps.

	Beijing Multiplex PCR amplification steps
PCR was carried out in a 25 μl reaction mixture, containing 75 ng of DNA, 0.33 mM of each dNTP, 0.33 μM of each Fw (5′GTCACTGAACGTGGCCGGCTC3′) and R1 (5′TCGGTCACCGTTTTTGTAGGTGACCGTC3′) primers, 0.13 μM of R2 (5′AGCAACCTCGCAATCTGACC3′) primer, 1xPCR buffer, 2.25 mM MgCl2, and 0.8units of Taq-DNA polymerase (Promega Corporation, Madison, Wisconsin, USA). Thermocycle program was set at initial denaturation at 95°C for 1 min, followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 66°C for 30 s, elongation at 72°C for 30 s, and final extension at 72°C for 3 min.
Conventional PCR amplification steps^§
PCR was carried out in a 25 μl reaction mixture, containing 75 ng of DNA, 0.4 mM of each dNTP, 0.4 μM of each Pt8 (5′GTGCGGATGGTCGCAGAGAT3′) and Pt9 (5′CTCG ATGCCCTCACGGTTCA3′) primers, 1xPCR buffer, 2.25 mM MgCl2, and 1 unit of Taq-DNA polymerase (Promega Corporation, Madison, Wisconsin, USA). Thermocycle program was set at initial denaturation at 94°C for 1 min, followed by 45 cycles of denaturation at 95°C for 60 s, annealing at 65°C for 60 s, elongation at 72°C for 60 s, and final extension at 72°C for 3 min.
Reference: C. Nakajima, A. Tamaru, Z. Rahim, et al., “Simple multiplex PCR assay for identification of Beijing family Mycobacterium tuberculosis isolates with a lineage-specific mutation in Rv0679c,” Journal of Clinical Microbiology, vol. 51, no. 7, pp. 2025–2032, 2013.
^§Reference: D. Rhienthong, A. M. Miranda, N. Udomsantisuk, et al., “A more reliable PCR for detection of mycobacterium tuberculosis in clinical samples,” Journal of Clinical Microbiology, vol. 32, no. 3, pp. 672–678, 1994.