Research Article
Prevalence and Genotype of Trichomonas vaginalis among Men in Xinxiang City, Henan Province, China
Table 1
Oligonucleotide primer sequences used for nested PCR in this research.
| Name | Sequences (5′⟶3′) | Description |
| Tv8S | TCTGGAATGGCTGAAGAAGACG | Forward primer for the actin gene of T. vaginalis in the first stage | Tv9R | CAGGGTACATCGTATTGGTC | Reverse primer for the actin gene of T. vaginalis in the first stage | Tv10S | CAGACACTCGTTATCG | Forward primer for the actin gene of T. vaginalis in the second stage | Tv11R | CGGTGAACGATGGATG | Reverse primer for the actin gene of T. vaginalis in the second stage |
|
|