Mediators of Inflammation / 2014 / Article / Tab 1

Research Article

Oral Administration of Herbal Mixture Extract Inhibits 2,4-Dinitrochlorobenzene-Induced Atopic Dermatitis in BALB/c Mice

Table 1


Primer nameSequence (5′-3′)

IL-4Forward: AAGAACACCACAGAGAGTGAGCTC
Reverse: TTTCAGTGTGGACTTCCACTC
IL-13Forward: AGCATGGTATGGAGTGTGGACCTG
Reverse: CAGTTGCTTTGTGTAGCTGAGCAG
IL-6Forward: AACCTTCCAAAGATGGCTGAA
Reverse: CAGGAACTGGATCAGGACTTT
IL-8Forward: TCAGTGCATAAAGACATACTCC
Reverse: TGGCATCTTCACTGATTCTTG
GAPDHForward: GAGGGGCCATCCACAGTCTTC
Reverse: CATCACCATCTTCCAGGAGCG