Mediators of Inflammation / 2014 / Article / Tab 1

Clinical Study

Low Intraprostatic DHT Promotes the Infiltration of CD8+ T Cells in BPH Tissues via Modulation of CCL5 Secretion

Table 1

The sequences of q-PCR primers.

GeneForward primerReverse primerSizeNumber

CCL2AGCAAGTGTCCCAAAGAAGCCATGGAATCCTGAACCCACT93NM_002982
CCL5ACCACTCCCTGCTGCTTTGACACTTGGCGGTTCCTTCG212NM_001278736
CCL8ATGCTGAAGCTCACACCCTTTCAAGCTCTGACTCTCAGTCCA363NM_005623
CCL15ATATAATAATAAAGAGACAAAAGAGGCTACTCTTTATTAGATGCATTACTTTCA134NM_032965
CCL19AGCTCCTCTGCACCAGACCTTAGTTGTAAACACCAGGCGG150NM_006274
CCL21GATGCAGCGTCTGGACAATTGGAGCCCTTTCCCTTC102NM_002989.3
CCL23TGTGTCCAGCTTCAGCATTCTTTGAAACGAACAGCGAGTG126NM_145898
CCL28AGAAGCCATACTTCCCATTGCAGCTTGCACTTTCATCCACTG208NM_148672
CXCL1AGGGAATTCACCCCAAGAACCACCAGTGAGCTTCCTCCTC204NM_001511
CXCL2CTGCCCTTACAGGAACAGAAATCAGGATTGAACTAACTTGGG250NM_002089
CXCL8ACCGGAAGGAACCATCTCACT ATCAGGAAGGCTGCCAAGAG75NM_000584
CXCL9ATTGGTGCCCAGTTAGCCCATCAGCAGTGTGAGCAGTG143NM_002416
CXCL10GCTGCTACTACTCCTGTAGGAAGGTGGAAGATGGGAAAGGTGAG159NM_001565
CXCL11ATGAGTGTGAAGGGCATGGCTCACTGCTTTTACCCCAGGG121NM_005409
CCR1TCAACAAAGTCACCCACTTCCGTGTCTCCCATGGCTTAGGA106NM_001295
CCR3TGACTGTGAGCGGAGCATGTATCTGCCCAGGTGC171NM_178329
CCR5GACTCTTGGGATGACGCGATCGGGTGTAAACTGAGC177NM_000579
CXCR2ACATTCCAAGCCTCATGTCCCTTAGAACATAGAGTGCCATGGG217NM_001168298
CXCR4ACGTAAAGCTAGAAATGATCCCCGTACACTGTAGGTGCTGAAATCAAC190NM_003467