Mediators of Inflammation / 2014 / Article / Tab 1

Research Article

Purine-Metabolizing Ectoenzymes Control IL-8 Production in Human Colon HT-29 Cells

Table 1

RT-PCR primers.

GeneForward primerReverse primerAmplicon (bp)

P2RY1 AAAACTAGCCCCCTGCAACTGATCTGATGCCGGATGAACT153
P2RY2 CCACCTGCCTTCTCACTAGCTGGGAAATCTCAAGGACTGG163
P2RY4 GCAGGGATATCATGGGTGACCCCAGGAAGGAACAGAAACA109
P2RY6 AGCTGGGCATGGAGTTAAGAGCTGACTGGGACCTCTCAAG139
P2RY11 CCTCTACGCCAGCTCCTATGCCTCTACGCCAGCTCCTATG211
P2RY12 TTTGCCCGAATTCCTTACACATTGGGGCACTTCAGCATAC192
P2RY13 CCCCTGGTACACTTGGAAGATACAGAGGAGGGGGTGATTG125
P2RY14 TCTTTGGGCTCATCAGCTTTTCCGTCCCAGTTCACTTTTC213
ENTPD1 GCCAGCAGAAAAGGAGAATGTGGGACCTTGGAATCACTTC159
ENTPD2 TCAATCCAGCTCCTTGAACCTCCCCAGTACAGACCCAGAC167
ENTPD3 TTGACCTCAGGGCTCAGTTTTGAGGGGGTTCACTGCTTAC159
ENTPD8 ACTGGGCTACATGCTGAACCGCACCATGAACACCACTTTG107
GAPDH CGACCACTTTGTCAAGCTCAAGGGGTCTACATGGCAACTG228
AK1β aGGAATTCGACCATGGGCTGCTGCTCGGAATTCGCAGCAGTGTGGGCTGTC412
AK1βACAGGAGACACGGCAGGACGGGACCTCTTCTCCTTGCTGCACCTCC385

Taken from reference [46].