FCGR2A Promoter Methylation and Risks for Intravenous Immunoglobulin Treatment Responses in Kawasaki Disease

Table 4

Possible transcription factor binding sites identified by JASPAR.

Transcription factor	Accession^a	Score	Relative score^b	Binding site sequence	Corresponding CpG site^c
SP1	P08047	7.430	0.87	GCTCTGCCTCC
NFATC2	Q13469	6.016	0.80	TTCTCCT
SOX10	NP_008872	6.636	0.90	TTTTGT/CCGTGT	I
NF-kB	NP_003989	9.015	0.85	GGGGTTTCAC	G^*
YY1	P25490	8.084	0.84	CAGGATGGTCTC	I
USF1	BAA76541	5.780	0.85	ATCTCCTGACC
Myc-Max	AAH36092	8.449	0.81	GACCTCGTGAT	J^*
SP2	Q02086	6.046	0.81	CACCCGCCTTGGCCT	K^*

The corresponding CpG sites reached the statistical significance in Table 2 or Table 3.
Accession number is the NCBI protein accession number.
^bThe relative score is provided by the JASPAR according to the similarity of motif sequence.
^cThe sequence in our study is listed as follows:
TGCAAGCTCTGCCTCCCG^AGGTTCACG^BCCATTCTCCTGCCTCAGCCTCCCG^CAGTAGCTGGGACTATCTGCCACCG^DCG^ECCCG^F GCTAAATTTTTTTTGTATTATTAGTAGAGACG^GGGGTTTCACCG^HTGTTAGCCAGGATGGTCTCG^IATCTCCTGACCTCG^J TGATCCACCCG^KCCTTGGCCTCCCAAAG.
The sites marked as A–K are the methylation loci.