Research Article
The Effect of Cyclooxygenase Inhibition on Tendon-Bone Healing in an In Vitro Coculture Model
Table 1
Primer sequences of target and reference genes.
| Target gene | Product size (base pairs) | Annealing temperature (°C) | Sequence |
| Actb | 200 | 66.5°C | Forward: 5′ CTCTGGCTCCTAGCACCATGAAGA 3′ | 66.3°C | Reverse: 5′ GTAAAACGCAGCTCAGTAACAGTCCG 3′ |
| Alpl | 96 | 61.3°C | Forward: 5′ GGCCAGCTACACCACAACA 3′ | 60.0°C | Reverse: 5′ CTGAGCGTTGGTGTTATATGTCTT 3′ |
| Bglap | 102 | n.a. | Qiagen (QuantiTect Primer Assay KIT BGLAP) | Cat. number: QT00259406 | (commercial product, no sequence available) |
| Fmod | 145 | 62.7°C | Forward: 5′ AGCAGTCCACCTACTACGACC 3′ | 62.2°C | Reverse: 5′ CAGTCGCATTCTTGGGGACA 3′ |
| Hprt | 173 | 67.1°C | Forward: 5′ GAGGAGTCCTGTTGATGTTGCCAG 3′ | 66.4°C | Reverse: 5′ GGCTGGCCTATAGGCTCATAGTGC 3′ |
| Runx2 | 207 | 60.3°C | Forward: 5′ CCAACCGAGTCATTTAAGGCT 3′ | 60.8°C | Reverse: 5′ GCTCACGTCGCTCATCTTG 3′ |
|
|