Forskolin Inhibits Lipopolysaccharide-Induced Modulation of MCP-1 and GPR120 in 3T3-L1 Adipocytes through an Inhibition of NF<svg xmlns:xlink="http://www.w3.org/1999/xlink" xmlns="http://www.w3.org/2000/svg" style="vertical-align:-0.2552099pt" id="M1" height="8.2614pt" version="1.1" viewBox="-0.0657574 -8.00619 9.20873 8.2614" width="9.20873pt"><g transform="matrix(.017,0,0,-0.017,0,0)"><path id="g5-232" d="M506 405C506 432 483 454 457 454C408 454 367 413 305 342L196 211L228 373C232 393 235 410 235 418C235 442 225 454 206 454C172 454 102 416 21 346L38 316C67 337 93 353 103 353C106 353 110 342 103 311L31 -2L34 -12C73 -5 114 0 153 3L187 157C193 165 207 183 219 189L267 67C293 2 321 -12 349 -12S434 11 496 100L472 127C444 94 423 81 416 81C407 81 399 92 380 127C362 161 317 265 310 285C335 314 378 363 420 363C433 363 444 361 454 354C461 349 467 349 475 355C489 365 506 385 506 405Z"/></g></svg>B

<table class="table-group" id="tab1"><tr><td><table class="table"><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr class="thead"><td class="align_left">Gene </td><td class="align_center">Forward primer (<svg height="11.786pt" id="M2" style="vertical-align:-0.3499002pt" version="1.1" viewbox="-0.0498162 -11.4361 39.9297 11.786" width="39.9297pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M153 550H386L412 615L406 623H120L82 318C104 327 142 338 184 338C294 338 347 275 347 187C347 112 305 39 221 39C160 39 119 71 97 89C88 97 80 96 71 90C59 80 50 67 49 57C48 45 52 36 66 23C80 9 123 -12 169 -12C221 -11 288 15 342 59C403 109 431 165 431 225C431 308 366 395 238 395C212 395 165 379 127 364L153 550Z" id="g113-54"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,6.24,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,13.668,0)"><path d="M901 255C852 301 765 395 674 502L652 487L727 373H69V323H759L804 255L760 188H69V138H727L652 23L674 8C765 115 852 209 901 255Z" id="g117-156"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="954" vert-adv-y="954"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,29.702,0)"><path d="M285 378C315 398 338 416 353 432C373 451 384 474 384 503C384 579 325 635 236 635H235C182 635 136 610 108 579L65 516L85 496C110 533 150 575 205 575C258 575 300 543 300 481C300 407 232 369 141 339L147 310C163 315 188 321 211 321C268 321 338 284 338 192C338 94 288 40 217 40C160 40 119 68 93 91C85 98 77 97 69 91C60 84 47 71 46 58C44 46 48 35 62 22C75 10 116 -12 162 -12C234 -12 424 62 424 224C424 297 373 359 285 376V378Z" id="g113-52"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,35.942,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g></svg>)</td><td class="align_center">Reverse primer (<svg height="11.786pt" id="M3" style="vertical-align:-0.3499002pt" version="1.1" viewbox="-0.0498162 -11.4361 39.9297 11.786" width="39.9297pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M153 550H386L412 615L406 623H120L82 318C104 327 142 338 184 338C294 338 347 275 347 187C347 112 305 39 221 39C160 39 119 71 97 89C88 97 80 96 71 90C59 80 50 67 49 57C48 45 52 36 66 23C80 9 123 -12 169 -12C221 -11 288 15 342 59C403 109 431 165 431 225C431 308 366 395 238 395C212 395 165 379 127 364L153 550Z" id="g113-54"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,6.24,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,13.668,0)"><path d="M901 255C852 301 765 395 674 502L652 487L727 373H69V323H759L804 255L760 188H69V138H727L652 23L674 8C765 115 852 209 901 255Z" id="g117-156"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="954" vert-adv-y="954"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,29.702,0)"><path d="M285 378C315 398 338 416 353 432C373 451 384 474 384 503C384 579 325 635 236 635H235C182 635 136 610 108 579L65 516L85 496C110 533 150 575 205 575C258 575 300 543 300 481C300 407 232 369 141 339L147 310C163 315 188 321 211 321C268 321 338 284 338 192C338 94 288 40 217 40C160 40 119 68 93 91C85 98 77 97 69 91C60 84 47 71 46 58C44 46 48 35 62 22C75 10 116 -12 162 -12C234 -12 424 62 424 224C424 297 373 359 285 376V378Z" id="g113-52"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="480" vert-adv-y="480"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,35.942,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g></svg>)</td></tr><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr><td class="align_left">mmNONO</td><td class="align_center">TGCTCCTGTGCCACCTGGTACTC</td><td class="align_center">CCGGAGCTGGACGGTTGAATGC</td></tr><tr><td class="align_left">mmACTB</td><td class="align_center">CCTGTGCTGCTCACCGAGGC</td><td class="align_center">GACCCCGTCTCCGGAGTCCATC</td></tr><tr><td class="align_left">mmYwhaz</td><td class="align_center">AAAAACAGCTTTCGATGAAGCC</td><td class="align_center">GCCGGTTAATTTTCCCCTCC</td></tr><tr><td class="align_left">mmMCP-1</td><td class="align_center">TTCACCAGCAAGATGATCCCA</td><td class="align_center">TCCTTCTTGGGGTCAGCACA</td></tr><tr><td class="align_left">mmTLR-4</td><td class="align_center">AGGACTCTGATCATGGCACTG</td><td class="align_center">GGAATGTCATCAGGGACTTTGC</td></tr><tr><td class="align_left">mmGPR120</td><td class="align_center">GGTGCCGGGACTGGTCATTGT</td><td class="align_center">AGAGCGTGCGGAAGAGTCGGT</td></tr><tr><td class="align_left">mm<i>β</i>-Arrestin 2</td><td class="align_center">ATGGGAGAAAAACCCGGGAC</td><td class="align_center">CACAGGGTCCACTTTGTCCA</td></tr><tr><td class="align_left">mmNF<i>κ</i>B1</td><td class="align_center">CTGCAGCTCTTACCCTGGAG</td><td class="align_center">GTAATTGCGTGGCAGAGTGG</td></tr><tr class="table-tr"><td colspan="3"><hr class="tbody-hr"/></td></tr></table></td></tr></table>

Mediators of Inflammation

tab1

Table 1

Table 1: Forskolin Inhibits Lipopolysaccharide-Induced Modulation of MCP-1 and GPR120 in 3T3-L1 Adipocytes through an Inhibition of NF<svg xmlns:xlink="http://www.w3.org/1999/xlink" xmlns="http://www.w3.org/2000/svg" style="vertical-align:-0.2552099pt" id="M1" height="8.2614pt" version="1.1" viewBox="-0.0657574 -8.00619 9.20873 8.2614" width="9.20873pt"><g transform="matrix(.017,0,0,-0.017,0,0)"><path id="g5-232" d="M506 405C506 432 483 454 457 454C408 454 367 413 305 342L196 211L228 373C232 393 235 410 235 418C235 442 225 454 206 454C172 454 102 416 21 346L38 316C67 337 93 353 103 353C106 353 110 342 103 311L31 -2L34 -12C73 -5 114 0 153 3L187 157C193 165 207 183 219 189L267 67C293 2 321 -12 349 -12S434 11 496 100L472 127C444 94 423 81 416 81C407 81 399 92 380 127C362 161 317 265 310 285C335 314 378 363 420 363C433 363 444 361 454 354C461 349 467 349 475 355C489 365 506 385 506 405Z"/></g></svg>B 

Mediators of Inflammation

Forskolin Inhibits Lipopolysaccharide-Induced Modulation of MCP-1 and GPR120 in 3T3-L1 Adipocytes through an Inhibition of NFB

Table 1