Associations of Functional MicroRNA Binding Site Polymorphisms in IL23/Th17 Inflammatory Pathway Genes with Gastric Cancer Risk

Table 2

PCR information and restriction enzymes used for genotyping of the four miRNA binding site SNPs.

Gene	SNP ID	Alleles	Annealing Tm (°C)	Restriction enzyme	Genotype (bp)	Primers
IL17A	rs3748067	C/T	58.2	ApoI	C: 317	Sense AGGATGGAGTGAAGAGGAA
					T: 202,115	Antisense AGAGATCAACAGACCAACAT
IL23R	rs10889677	A/C	56.6	MnlI	A: 165	Sense TGCTCCTACCATCACCAT
					C: 86,79	Antisense TGAGGCGTCCACATAATG
IL17RA	rs1468488	T/C	59.6	AluI	T: 164,94,92	Sense GGAGGAAGAGGAGGAAGAG
					C: 256,94	Antisense GGATAGACGATAACCAGACC
IL17RA	rs887796	A/G	56.6	BanI	A: 454	Sense AATTCTCCAAGGTGTCTGTT
					G: 263,191	Antisense GATCAAGATAGTAGGCAGGAA

SNP: single-nucleotide polymorphism.