Table 1: The real-time qRT-PCR primers used in this study.

PrimersGenBank numberSequence (5-3)TmSize (bp)

β-ActinNM_001101.3F: TTCGTGGATGCCACAGGACT61°C212
R: GGGAAATCGTGCGTGACATT
IL-1βNM_000576.2F: ATGACCTGAGCACCTTCTTTC62°C82
R: TGCACATAAGCCTCGTTATCC
IL-2NM_000586.3F: CTCACCAGGATGCTCACATTTA60°C240
R: TACAATGGTTGCTGTCTCATCA
IL-6NM_000600.3F: GACAGCCACTCACCTCTTCAG59°C172
R: CATCCATCTTTTTCAGCCATC
IL-8NM_000584.3F: TTGCCAAGGAGTGCTAAAGAA61°C215
R: GCCCTCTTCAAAAACTTCTCC
IL-10NM_000572.2F: TTTAAGGGTTACCTGGGTTGC60°C98
R: TTGATGTCTGGGTCTTGGTTC
IL-12βNM_000882.3F: AGCAGTGAGGTCTTAGGCTCTG60°C179
R: TTGGGTTCTTTCTGGTCCTTTA
TNF-αNM_000594.2F: TAGCCCATGTTGTAGCAAACC63°C136
R: ATGAGGTACAGGCCCTCTGAT
MyD88NM_002468.4F: CCAGTTTGTGCAGGAGATGA61°C288
R: AGGATGCTGGGGAACTCTTT
TLR2NM_003264.3F: ATGCTGCCATTCTCATTCTTCT60°C101
R: CTCCAGGTAGGTCTTGGTGTTC
TLR4NM_138554.3F: CTTCTCAACCAAGAACCTGGAC60°C158
R: TAGAGAGGTGGCTTAGGCTCTG
TLR6NM_006068.4F: CTACCGCTGAAAACCAAAGTCT60°C322
R: ACTCACAATAGGATGGCAGGAT
TLR8NM_138636.4F: CCTGGCTCACCATTTGTTTTA60°C198
R: TTTTTGTCTCGGCTCTCTTCA
NF-κBNM_002502.5F: AGGAGAGGATGAAGGAGTTGTG62°C218
R: CCAGAGTAGCCCAGTTTTGTC
TRAF6NM_145803.2F: TAGCCCTGGATTCTACACTGG63°C215
R: CTTCGTGGTTTTGCCTTACAG