Mediators of Inflammation / 2018 / Article / Tab 2

Research Article

Neostigmine Attenuates Proinflammatory Cytokine Expression in Preoptic Area but Not Choroid Plexus during Lipopolysaccharide-Induced Systemic Inflammation

Table 2

Full names and abbreviations of all genes analysed by Real-Time PCR.

GenBank acc. no.GeneAmplicon size
(bp)
Forward/reverseSequence
5 → 3
Reference

NM_001034034GAPDH (glyceraldehyde-3-phosphate dehydrogenase)134ForwardAGAAGGCTGGGGCTCACT[8]
ReverseGGCATTGCTGACAATCTTGA
U39357ACTB (beta actin)168ForwardCTTCCTTCCTGGGCATGG[8]
ReverseGGGCAGTGATCTCTTTCTGC
BC108088.1HDAC1 (histone deacetylase1)115ForwardCTGGGGACCTACGGGATATT[8]
ReverseGACATGACCGGCTTGAAAAT
X54796.1IL-1β (interleukin 1-beta)137ForwardCAGCCGTGCAGTCAGTAAAA[8]
ReverseGAAGCTCATGCAGAACACCA
NM_001206735.1IL1R1 (interleukin 1 receptor, type I)124ForwardGGGAAGGGTCCACCTGTAAC[8]
ReverseACAATGCTTTCCCCAACGTA
NM_001046210.1IL1R2 (interleukin 1 receptor, type II)161ForwardCGCCAGGCATACTCAGAAA[28]
ReverseGAGAACGTGGCAGCTTCTTT
NM_001308595.1IL1RN (interleukin 1 receptor antagonist)145ForwardAGGATCTGGGATGTCAACCA[28]
ReverseCATGGATCCCCAGGAACATA
NM_001009392.1IL6 (interleukin 6)165ForwardGTTCAATCAGGCGATTTGCT[8]
ReverseCCTGCGATCTTTTCCTTCAG
NM_001110785IL6R (interleukin 6 receptor)149ForwardTCAGCGACTCCGGAAACTAT[8]
ReverseCCGAGGACTCCACTCACAAT
XM_004016974IL6ST (glycoprotein 130)139ForwardGGCTTGCCTCCTGAAAAACC[29]
ReverseACTTCTCTGTTGCCCACTCAG
NM_001024860TNF (tumor necrosis factor)153ForwardCAAATAACAAGCCGGTAGCC[8]
ReverseAGATGAGGTAAAGCCCGTCA
NM_174674TNFRSF1A (tumor necrosis factor receptor, type 1)137ForwardAGGTGCCGGGATGAAATGTT[8]
ReverseCAGAGGCTGCAGTTCAGACA
NM_001040490TNFRSF1B (tumor necrosis factor receptor, type 2)122ForwardACCTTCTTCCTCCTCCCAAA[8]
ReverseAGAAGCAGACCCAATGCTGT
BC_149340CHRNA7 (neuronal acetylcholine receptor subunit alpha-7)114ForwardTGGAAGCCAGACATTCTCCT[7]
ReverseGATGCCTGGAGGGAGGTACT

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.