Danhong Huayu Koufuye Prevents Diabetic Retinopathy in Streptozotocin-Induced Diabetic Rats via Antioxidation and Anti-Inflammation

Chen, Wenpei; Yao, Xiaolan; Zhou, Chenghao; Zhang, Ziyang; Gui, Gang; Lin, Baoqin

doi:https://doi.org/10.1155/2017/3059763

Mediators of Inflammation

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusion Conflicts of Interest Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2017 | Article ID 3059763 | https://doi.org/10.1155/2017/3059763

Danhong Huayu Koufuye Prevents Diabetic Retinopathy in Streptozotocin-Induced Diabetic Rats via Antioxidation and Anti-Inflammation

Wenpei Chen,¹Xiaolan Yao,¹Chenghao Zhou,¹Ziyang Zhang,¹Gang Gui,¹and Baoqin Lin¹

Academic Editor: Magdalena Klink

Received17 Nov 2016

Revised01 Mar 2017

Accepted09 Mar 2017

Published30 May 2017

Abstract

Danhong Huayu Koufuye (DHK), a traditional Chinese prescription, is used to treat central retinal vein occlusion clinically. We previously reported that DHK prevented diabetic retinopathy (DR) in rats. Moreover, we found that it protected endothelial cells from hyperglycemia-induced apoptosis through antioxidation and anti-inflammation. Here, we investigated whether antioxidative and anti-inflammatory activities of DHK contributed to its therapeutic effect on DR in streptozotocin- (STZ-) induced diabetic rats. DHK significantly blocked the breakdown of the blood-retinal barrier (BRB) and increased the thickness of the inner nuclear layer (INL), as well as suppressed the swelling of the ganglion cell layer (GCL) in diabetic retinas. DHK remarkably increased the activities of superoxide dismutase (SOD) and glutathione peroxidase (GPx) in plasma, and decreased serum level of nitric oxide (NO). Moreover, DHK markedly reduced the serum levels of vascular endothelial growth factor (VEGF) and intercellular adhesion molecule-1 (ICAM-1). Furthermore, DHK significantly downregulated protein expressions of VEGF and inducible NO synthase (iNOS) and mRNA expression of ICAM-1 in retinas. These results suggest that the antioxidative and anti-inflammatory activities of DHK may be important mechanisms involved in the protective effect of DHK on DR in STZ-induced diabetic rats.

1. Introduction

Diabetic retinopathy (DR), a slow-progressing microvascular complication of diabetes, is the leading cause of blindness among adults aged 20–74 years in the world [1]. The blood-retinal barrier (BRB) breakdown occurs at the early stage of DR [2]. The consequent retinal vascular hyperpermeability results in macular edema, which aggravates the loss of central vision in diabetic patients. BRB disruption attributes to oxidative stress, inflammation, and damage of tight junction integrity, as well as overexpression of vascular endothelial growth factor (VEGF) and advanced glycation end products [3–5].

Hyperglycemia-mediated oxidative damage is a vital pathological mechanism involved in the process of DR [6]. Long-term and persistent hyperglycemia induces the overproduction of reactive oxygen species (ROS) that triggers oxidative stress [7–9]. Low levels or low activities of antioxidative enzymes contribute to further accumulation of ROS, and thus enhance oxidative stress in DR patients [10]. Suppression of oxidative injury inhibits pericyte loss, acellular capillaries formation, capillary basement membrane thickening, and BRB breakdown [11, 12]. Oxidative stress occurs at a very early stage and eventually worsens over the course of diabetes and its complications [13].

Inflammation plays a pivotal role in retinal abnormality in macular edema, ischemia, and neovascularization [14]. There are two pathways associated with inflammation that contribute to BRB breakdown: inflammatory cytokine-induced death of retinal cells pathway and proinflammatory factor-mediated leukostasis and vascular occlusion pathway [15]. Proinflammatory proteins such as inducible nitric oxide synthase (iNOS), intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and VEGF are highly expressed in diabetic retinas [16–18]. These molecules prompt leukocytes to adhere to the vascular walls and stimulate the release of inflammatory cytokines and vascular permeability factors, which result in BRB breakdown and consequent vascular hyperpermeability [19].

Danhong Huayu Koufuye (DHK), a traditional Chinese prescription, is manufactured by Guangzhou Baiyun Mountain and Hutchison Whampoa Ltd.. It contains 29% Salviae Miltiorrhizae Radix et Rhizoma, 11.5% Angelicae Sinensis Radix, 15% Chuanxiong Rhizoma, 11.5% Persicae Semen, 11.5% Carthami Flos, 11.5% Bupleuri Radix, and 10% Aurantii Fructus. DHK alone has a protective effect on DR in streptozotocin- (STZ-) induced diabetic SD rats [20], and it in combination with metformin has a preventive and therapeutic effect on DR in spontaneous type 2 diabetic ZDF rats [21]. Moreover, our previous laboratory study has shown that the antioxidative and anti-inflammatory activities of DHK contribute to protecting endothelial cells from high glucose–induced injury. Furthermore, it inhibits deep venous thrombosis in rats via anti-inflammatory activities [22].

In the present study, we investigated whether antioxidative and anti-inflammatory activities of DHK were involved in the protective effect of DHK on DR in STZ-induced diabetic rats.

2. Materials and Methods

2.1. Reagents

DHK was kindly provided by Guangzhou Baiyun Mountain and Hutchison Whampoa Ltd. (Guangdong, China). STZ, Evans blue (EB) dye and formamide were purchased from Sigma-Aldrich (California, USA). Pentobarbital sodium salt and xylazine hydrochloride injection were purchased from Merck (Darmstadt, Germany) and Huamu Animal Health Product Co. Ltd. (Jilin, China), respectively. Superoxide dismutase (SOD) and glutathione peroxidase (GPx) assay kits were provided by Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). Thiobarbituric acid reactive substances (TBARS) assay kit was obtained from Cayman Chemical (Michigan, USA). VEGF, ICAM-1, and nitric oxide (NO) assay kits were obtained from R&D Systems (Minneapolis, USA). TRIzol reagent was obtained from Invitrogen (California, USA). M-MLV Rtase cDNA synthesis kit and SYBR Premix Ex Taq II kit were both purchased from Takara Bio Inc. (Dalian, China). Anti-VEGF and anti-iNOS antibodies were bought from Abcam (Cambridge, UK) and Santa Cruz (Texas, USA), respectively. Hematoxylin, eosin, normal goat serum, normal goat IgG, 3% hydrogen peroxide, EDTA antigen retrieval solution, and rabbit anti-IgG staining kit were provided by ZSGB-BIO OriGene (Beijing, China).

2.2. Animals

Male SD rats (250 ± 20 g) were provided by the Laboratory Animal Center of Guangzhou University of Chinese Medicine (Guangdong, China). All animals had free access to food and water. They were maintained under a 12 : 12 h cyclic lighting schedule with 22.0–24.0°C and 50–60% humidity. All experiments were performed in accordance with the Local Committee on Animal Care and Use of Guangzhou University of Chinese Medicine (Approval no. SCXK 2013-0020).

2.3. Induction of Diabetes and Drug Administration

Rats were fasted for 13 h and then intraperitoneally injected with 60 mg/kg STZ dissolved in citrate buffer (pH 4.3-4.4). Seven days after injection, rats with fasting blood glucose between 16.7 and 33.3 mmol/L were randomly divided into two groups: diabetic control group and DHK treatment group. Age-matched rats were regarded as normal control. The rats in the normal and diabetic control groups were orally administered with distilled water (3.2 mL/kg), and the rats in the DHK treatment group were orally given with DHK (3.2 mL/kg). All rats were treated once daily, consecutively for 16 weeks.

2.4. Analysis of BRB Breakdown

After 16 weeks of DHK treatment, the breakdown of BRB in rats was determined as described previously [23]. Firstly, rats were anesthetized with pentobarbital sodium salt (18 mg/kg, intraperitoneally) and xylazine hydrochloride injection (0.19 mL/kg, intramuscularly), and then intravenously injected with EB solution (45 mg/kg). Two minutes later, 0.1 mL blood sample was collected from the iliac artery to obtain the plasma time-averaged EB concentration at a 15 min interval for 2 h. After the final collection of blood, rats were perfused with 37°C citrate-buffered 1% paraformaldehyde for 2 min. Then, the eyes were removed and the retinas were dissected immediately. The retinas were dried, weighed, and incubated in 300 μL formamide at 70°C for 18 h. Finally, the mixture was centrifuged at the speed of 20,000 rpm for 30 min to obtain 180 μL retinal EB solution. The absorbances of the EB solution were taken at 620 nm and 740 nm using a microplate reader (Multiskan GO, Thermo Scientific). The applied absorbance was the difference between these two values. The concentrations of EB in the dry retinas and plasma were calculated from a standard curve of EB. The breakdown of BRB was calculated as follows:

The final results were expressed as the percentage relative to the normal group.

2.5. Measurement of SOD and GPx Activities and Malondialdehyde (MDA) Level in Plasma

After 16 weeks of distilled water or DHK treatment, the rats were anesthetized. Fresh arteriopuncture blood samples were then collected into vacutainer with sodium citrate (3.2% w/v) and centrifuged at a speed of 3500 rpm for 10 min. Plasma samples were obtained and used to determine the activities of SOD and GPx and the level of MDA.

2.6. Measurement of Serum Levels of VEGF, ICAM-1, and NO

At the end of the experiment, fresh arteriopuncture blood samples were collected into separation gel tubes and centrifuged at a speed of 3500 rpm for 5 min to obtain serum samples. The levels of VEGF, ICAM-1, and NO in serum were determined with commercial assay kits.

2.7. Histological Study of the Retina

After blood samples were taken, the right eyes of rats were removed and fixed with 4% paraformaldehyde in phosphate-buffered saline. Paraffin sections (4 μm) of the bulbus oculi were then stained with hematoxylin and eosin (H&E). Pathological pictures of the retinas were taken by an optical microscope (Carl Zeiss, Oberkochen, Germany).

2.8. Determination of the Retinal ICAM-1 mRNA Expression

After blood samples were taken, the left eyes of rats were removed and then the retinas were collected. Total RNA was extracted from the retinal tissues using TRIzol reagent. Total RNA samples were quantified spectrophotometrically at 260 and 280 nm, with the A260/A280 ratio ranging from 1.8 to 2.0.

cDNA was synthesized according to the manufacturer’s instructions of M-MLV RTase cDNA synthesis kit. The polymerase chain reaction (PCR) was performed using ABI 7500 real-time PCR device (New York, USA) according to the protocol of SYBR Premix Ex Taq II kit. Cycling conditions were as follows: 95°C, 30 s, and 45 cycles of 95°C, 3 s, 60°C, 34 s. The primers of ICAM-1 were GCCTGGGGTTGGAGACTAAC (forward) and CTGTCTTCCCCAATGTCGC (reverse). The primers of GAPDH were AGACAGCCGCATCTTCTTGT (forward) and TGATGGCAACAATGTCCACT (reverse). Quantification of ICAM-1 mRNA was normalized to GAPDH mRNA, and analysis was performed using 2^−ΔΔCt method. The final results were expressed as percentage relative to the normal group.

2.9. Determination of the Retinal VEGF and iNOS Protein Expressions

The protein expressions of VEGF and iNOS in the retinas were assessed by immunohistochemical assay. Paraffin sections (4 μm) of the bulbus oculi were blocked with 3% hydrogen peroxide for 10 min, and then underwent heat treatment with EDTA antigen retrieval buffer solution for 15 min. When slides were cooled to the room temperature, the retinal tissues were blocked with normal goat serum for 10 min and then incubated with primary antibodies of VEGF (ab46154, 1 : 200 dilution) or iNOS (sc-649, 1 : 50 dilution) at 4°C overnight. Rabbit anti-IgG staining kit was used in subsequent steps according to the manufacturer’s instructions. Normal goat IgG was used as a negative control. Six pathological pictures of each retina were taken by an optical microscope (Carl Zeiss, Oberkochen, Germany). These pictures were then analyzed with the Image-Pro Plus Analysis Software 6.0 (Rockville, MD, USA).

2.10. Statistical Analysis

Data were expressed as mean ± standard error of the mean (SEM) and analyzed by Statistical Package for the Social Sciences version 21.0 (SPSS 21.0). One-way analysis of variance (ANOVA) test was performed, and post hoc multiple comparisons were conducted with LSD. was regarded to be significant.

3. Results

3.1. DHK Blocks BRB Breakdown in STZ-Treated Rats

As shown in Figure 1, BRB permeability was significantly increased by 118.9% in diabetic control rats ( versus normal control rats). DHK significantly decreased the breakdown of BRB by 136.3% ( versus diabetic control group).

3.2. DHK Attenuates Oxidative Stress in STZ-Treated Rats

As compared with normal control rats, the plasma activities of SOD and GPx in diabetic control rats were markedly decreased by 16.8% () and 81.5% (), respectively, while serum NO level was significantly increased by about 1.4-fold (). DHK significantly increased SOD activity and decreased NO level by 19.1% ( versus the diabetic control group) and 55.1% ( versus the diabetic control group), respectively (Figures 2(a) and 2(c)). DHK remarkably enhanced GPx activity by about 5.5-fold ( versus the diabetic control group; Figure 2(b)). There were no differences among groups in the MDA level (data not shown).

(a)

(b)

(c)

3.3. DHK Decreases Serum Levels of VEGF and ICAM-1 in STZ-Treated Rats

As compared with normal control rats, serum levels of VEGF and ICAM-1 in diabetic rats were markedly increased by about 107.3% () and 45.9% (), respectively (Figure 3). DHK treatment notably decreased VEGF and ICAM-1 levels by 57.9% ( versus the diabetic control group) and 25.5% ( versus the diabetic control group), respectively.

(a)

(b)

3.4. DHK Protects the Retinal Structure and Downregulates the Retinal Protein Expressions of VEGF and iNOS in STZ-Treated Rats

In rodents, the retina is composed of five basic layers: ganglion cell layer (GCL), inner plexiform layer (IPL), inner nuclear layer (INL), outer plexiform layer (OPL), and outer nuclear layer (ONL) [5]. Thin IPL and INL and swollen GCL were presented in the retinas of diabetic control rats. DHK increased the thickness of INL and improved the swollen GCL (Figure 4(a)).

(a)

(b)

(c)

(d)

(e)

Figure 4

Effects of DHK on morphological changes (a), protein expressions of VEGF (b and d), and iNOS (c and e) in diabetic retinas. Seven days after injection of STZ, rats were orally administered for 16 weeks. At the end of the experiment, rats were sacrificed, and the right eyeballs were removed and then fixed with 4% paraformaldehyde in phosphate-buffered saline. Paraffin sections (4 μm) of the bulbus oculi were then stained with H&E or applied for immunohistochemical studies. GCL: ganglion cell layer; IPL: inner plexiform layer; INL: inner nuclear layer; OPL: outer plexiform layer; ONL: outer nuclear layer; IOD: integral optical density. Scale bar: 50 μm. Values were expressed as , , and .

High VEGF expression was mainly identified in GCL, IPL, and INL in diabetic retinas, whereas weak staining was observed in normal retinas (Figures 4(b) and 4(d)). iNOS was abnormally overexpressed in GCL, IPL, and INL in diabetic retinas (Figures 4(c) and 4(e)). DHK remarkably downregulated these two protein expressions in diabetic retinas (Figures 4(d) and 4(e)).

3.5. DHK Downregulates the Retinal ICAM-1 mRNA Expression in STZ-Treated Rats

Diabetic control rats presented a marked upregulation of ICAM-1 mRNA ( versus the normal control group). DHK significantly decreased mRNA expression of ICAM-1 ( versus the diabetic control group; Figure 5).

4. Discussion

The BRB consists of vascular endothelial cells and retina pigment epithelium cells. The differentiation of endothelial cells requires interaction with the glial cells and pericytes [5]. Therefore, the injury of these cells results in retinal morphological changes such as edema and/or thinness [5, 24], which contribute to vision loss in DR. In the present study, DHK significantly decreased the breakdown of BRB, increased the thickness of INL, and inhibited the swelling of GCL (Figures 1 and 4(a)), which reveals that the protective effect of DHK on the retinal structure helps to reduce the BRB breakdown.

Oxidative stress is considered as an important factor in the pathology of DR. Persistent hyperglycemia induces ROS formation and triggers oxidative stress. ROS injures the retinal endothelial cells through damaging proteins, lipids, and DNA [25, 26]. ROS-mediated damage of the retinal cells forms a special memory in the microvasculature, so this damage sustains even when glucose has been normalized [27].

In addition to ROS, low-level defense system is another key point responsible for the imbalance of the redox status and oxidative stress in DR. Antioxidant enzymes such as SOD, GPx, and catalase (CAT) are the most important components of the defense system and take active part in ROS homeostasis. SOD is the first antioxidant enzyme against ROS. It coverts O²⁻ into H₂O₂, which is further degraded into O₂ and H₂O by GPx or CAT [26, 28]. A remarkable decline of SOD, GPx, and CAT was found in DR patients, animals, and high glucose–induced retinal endothelial cells [10, 28, 29]. DHK significantly increased the activities of SOD and GPx to normal level (Figures 2(a) and 2(b)). These results suggest that DHK has a protective effect on BRB via reducing oxidative stress.

Not only oxidative damage but also inflammation is responsible for the process of DR. ICAM-1 is highly expressed in diabetic endothelial cells [30]. It mediates the interaction between leukocytes and capillary endothelial cells and then initiates inflammatory response [31]. CD18, a ligand of ICAM-1, remarkably arises in patients with each stage of DR [32] and contributes to leukostasis. Diabetic ICAM-1- or CD18-deficient mice are protected from leukostasis, endothelial cells injury, pericyte loss, acellular capillaries, and BRB breakdown [33]. Thus, ICAM-1 is an important proflammatory factor in DR.

Intraocular VEGF expression is markedly upregulated in diabetic patients, rats, and mice [18, 34, 35]. VEGF damages BRB not only through breaking endothelial tight junctions, increasing vascular permeability, and leading to retinal edema but also through inducing leukocyte aggregation, touching off inflammatory response, and injuring endothelial cells [3]. VEGF induces high expression of ICAM-1 in the retina and then activates the adhesion of leukocytes [36]. The inflammation in turn stimulates further release of VEGF [19, 36], which eventually leads to the breakdown of BRB. DHK significantly downregulated VEGF and ICAM-1 expressions (Figures 3, 4(d), and 5). These results suggest that DHK protects BRB via anti-inflammation.

NO is generated by neuronal NOS (nNOS), endothelial NOS (eNOS), and iNOS. Increased serum NO level is associated with increased severity of DR since it breaks reactive nitrogen species homeostasis and injures the retinal structure [37, 38]. The function of endothelial cells is damaged, and subsequently, eNOS is downregulated in diabetic patients and animals. So, the increased serum NO may be from iNOS [39]. Retinal iNOS is mainly expressed in IPL, INL, and OPL and is upregulated in diabetic ones [40–42]. Diabetic iNOS knockout mice are protected from leukostasis and BRB breakdown because of low expression of ICAM-1 and high expressions of tight junction proteins [41]. DHK significantly decreased serum NO level and reduced the retinal iNOS protein expression (Figures 2(c) and 4(e)), which indicates that DHK protects the integrity of BRB via regulating nitrogen species homeostasis, reducing oxidative stress, and ameliorating inflammatory response.

5. Conclusion

In summary, DHK ameliorates BRB breakdown and protects the retinal structure in STZ-induced diabetic rats. DHK enhances the activities of SOD and GPx and inhibits the production of NO, VEGF, iNOS, and ICAM-1. These results suggest that the antioxidative and anti-inflammatory activities of DHK may be important mechanisms involved in the protective effect of DHK on DR in STZ-induced diabetic rats.

Conflicts of Interest

The authors declare that they have no conflict of interests.

Acknowledgments

This study was financially supported by the National Natural Science Foundation of China (81303282) and the Department of Education of Guangdong Province (Yq2013044).

References

D. S. Fong, L. Aiello, T. W. Gardner et al., “Retinopathy in diabetes,” Diabetes Care, vol. 27, Supplement 1, pp. S84–S87, 2004.
View at: Google Scholar
A. D. Carmo, P. Ramos, A. Reis, R. Proenca, and J. G. Cunha-Vaz, “Breakdown of the inner and outer blood retinal barrier in streptozotocin-induced diabetes,” Experimental eye Research, vol. 67, no. 5, pp. 569–575, 1998.
View at: Publisher Site | Google Scholar
C. Zhang, H. Wang, J. Nie, and F. Wang, “Protective factors in diabetic retinopathy: focus on blood-retinal barrier,” Discovery Medicine, vol. 18, no. 98, pp. 105–112, 2014.
View at: Google Scholar
M. T. Bolinger and D. A. Antonetti, “Moving past anti-VEGF: novel therapies for treating diabetic retinopathy,” International Journal of Molecular Sciences, vol. 17, no. 9, p. 1498, 2016.
View at: Publisher Site | Google Scholar
T. Frey and D. A. Antonetti, “Alterations to the blood-retinal barrier in diabetes: cytokines and reactive oxygen species,” Antioxidants and Redox Signaling, vol. 15, no. 5, pp. 1271–1284, 2011.
View at: Publisher Site | Google Scholar
T. Behl, I. Kaur, and A. Kotwani, “Implication of oxidative stress in progression of diabetic retinopathy,” Survey of Ophthalmology, vol. 61, no. 2, pp. 187–196, 2016.
View at: Publisher Site | Google Scholar
Y. Du, C. M. Miller, and T. S. Kern, “Hyperglycemia increases mitochondrial superoxide in retina and retinal cells,” Free Radical Biology & Medicine, vol. 35, no. 11, pp. 1491–1499, 2003.
View at: Google Scholar
M. S. Ola, M. I. Nawaz, M. M. Siddiquei, S. Al-Amro, and A. M. Abu El-Asrar, “Recent advances in understanding the biochemical and molecular mechanism of diabetic retinopathy,” Journal of Diabetes and Its Complications, vol. 26, no. 1, pp. 56–64, 2012.
View at: Publisher Site | Google Scholar
J. M. Santos, G. Mohammad, Q. Zhong, and R. A. Kowluru, “Diabetic retinopathy, superoxide damage and antioxidants,” Current Pharmaceutical Biotechnology, vol. 12, no. 3, pp. 352–361, 2011.
View at: Publisher Site | Google Scholar
M. F. El-Bab, N. S. Zaki, M. A. Mojaddidi, M. Al-Barry, and H. A. El-Beshbishy, “Diabetic retinopathy is associated with oxidative stress and mitigation of gene expression of antioxidant enzymes,” International Journal of General Medicine, vol. 6, pp. 799–806, 2013.
View at: Publisher Site | Google Scholar
Z. Zheng, H. Chen, G. Ke et al., “Protective effect of perindopril on diabetic retinopathy is associated with decreased vascular endothelial growth factor-to-pigment epithelium-derived factor ratio: involvement of a mitochondria-reactive oxygen species pathway,” Diabetes, vol. 58, no. 4, pp. 954–964, 2009.
View at: Publisher Site | Google Scholar
J. Li, J. J. Wang, Q. Yu, K. Chen, K. Mahadev, and S. X. Zhang, “Inhibition of reactive oxygen species by lovastatin downregulates vascular endothelial growth factor expression and ameliorates blood-retinal barrier breakdown in db/db mice: role of NADPH oxidase 4,” Diabetes, vol. 59, no. 6, pp. 1528–1538, 2010.
View at: Publisher Site | Google Scholar
M. Brownlee, “The pathobiology of diabetic complications: a unifying mechanism,” Diabetes, vol. 54, no. 6, pp. 1615–1625, 2005.
View at: Publisher Site | Google Scholar
F. Bandello, R. Lattanzio, I. Zucchiatti, and C. D. Turco, “Pathophysiology and treatment of diabetic retinopathy,” Acta Diabetologica, vol. 50, no. 1, pp. 1–20, 2013.
View at: Publisher Site | Google Scholar
P. U. Dugel, F. Bandello, and A. Loewenstein, “Dexamethasone intravitreal implant in the treatment of diabetic macular edema,” Clinical Ophthalmology, vol. 9, pp. 1321–1335, 2015.
View at: Publisher Site | Google Scholar
S. Ahmad, N. M. ElSherbiny, M. S. Jamal et al., “Anti-inflammatory role of sesamin in STZ induced mice model of diabetic retinopathy,” Journal of Neuroimmunology, vol. 295-296, pp. 47–53, 2016.
View at: Publisher Site | Google Scholar
C. Gustavsson, C. D. Agardh, A. V. Zetterqvist, J. Nilsson, E. Agardh, and M. F. Gomez, “Vascular cellular adhesion molecule-1 (VCAM-1) expression in mice retinal vessels is affected by both hyperglycemia and hyperlipidemia,” PLoS One, vol. 5, no. 9, article e12699, 2010.
View at: Publisher Site | Google Scholar
S. Dongare, S. K. Gupta, R. Mathur et al., “Zingiber officinale attenuates retinal microvascular changes in diabetic rats via anti-inflammatory and antiangiogenic mechanisms,” Molecular Vision, vol. 22, pp. 599–609, 2016.
View at: Google Scholar
S. Kaštelan, M. Tomić, A. G. Antunica, J. S. Rabatić, and S. Ljubić, “Inflammation and pharmacological treatment in diabetic retinopathy,” Mediators of Inflammation, vol. 2013, Article ID 213130, 8 pages, 2013.
View at: Publisher Site | Google Scholar
B. Q. Lin, J. Y. Zhou, Y. Ma, Y. J. Deng, C. J. Zheng, and J. L. Lin, “Preventive effect of danhong huayu koufuye on diabetic retinopathy in rats,” International Journal of Ophthalmology, vol. 4, no. 6, pp. 599–604, 2011.
View at: Publisher Site | Google Scholar
W. P. Chen, Y. D. Wang, Y. Ma et al., “Danhong Huayu Koufuye combined with metformin attenuated diabetic retinopathy in Zucker diabetic fatty rats,” International Journal of Ophthalmology, vol. 8, no. 6, pp. 1094–1100, 2015.
View at: Publisher Site | Google Scholar
Z. Zhang, L. Hu, W. Chen, C. Zhou, G. Gui, and B. Lin, “Danhong Huayu Koufuye prevents deep vein thrombosis through anti-inflammation in rats,” The Journal of Surgical Research, vol. 201, no. 2, pp. 340–347, 2016.
View at: Publisher Site | Google Scholar
X. Shi, S. Liao, H. Mi et al., “Hesperidin prevents retinal and plasma abnormalities in streptozotocin-induced diabetic rats,” Molecules (Basel, Switzerland), vol. 17, no. 11, pp. 12868–12881, 2012.
View at: Publisher Site | Google Scholar
M. H. Madeira, R. Boia, P. F. Santos, A. F. Ambrósio, and A. R. Santiago, “Contribution of microglia-mediated neuroinflammation to retinal degenerative diseases,” Mediators of Inflammation, vol. 2015, Article ID 673090, 15 pages, 2015.
View at: Publisher Site | Google Scholar
B. Marengo, M. Nitti, A. L. Furfaro et al., “Redox homeostasis and cellular antioxidant systems: crucial players in cancer growth and therapy,” Oxidative Medicine and Cellular Longevity, vol. 2016, Article ID 6235641, 16 pages, 2016.
View at: Publisher Site | Google Scholar
A. Chawla, R. Chawla, and S. Jaggi, “Microvascular and macrovascular complications in diabetes mellitus: distinct or continuum?” Indian Journal of Endocrinology and Metabolism, vol. 20, no. 4, pp. 546–551, 2016.
View at: Publisher Site | Google Scholar
M. A. Ihnat, J. E. Thorpe, C. D. Kamat et al., “Reactive oxygen species mediate a cellular ‘memory’ of high glucose stress signalling,” Diabetologia, vol. 50, no. 7, pp. 1523–1531, 2007.
View at: Publisher Site | Google Scholar
Y. Sun, C. Xiu, W. Liu, Y. Tao, J. Wang, and Y. I. Qu, “Grape seed proanthocyanidin extract protects the retina against early diabetic injury by activating the Nrf2 pathway,” Experimental and Therapeutic Medicine, vol. 11, no. 4, pp. 1253–1258, 2016.
View at: Publisher Site | Google Scholar
Y. Fan, Y. Qiao, J. Huang, and M. Tang, “Protective effects of Panax notoginseng saponins against high glucose-induced oxidative injury in rat retinal capillary endothelial cells,” Evidence-Based Complementary and Alternative Medicine, vol. 2016, Article ID 5326382, 9 pages, 2016.
View at: Publisher Site | Google Scholar
F. Haubner, K. Lehle, D. Münzel, C. Schmid, D. E. Birnbaum, and J. G. Preuner, “Hyperglycemia increases the levels of vascular cellular adhesion molecule-1 and monocyte chemoattractant protein-1 in the diabetic endothelial cell,” Biochemical and Biophysical Research Communications, vol. 360, no. 3, pp. 560–565, 2007.
View at: Publisher Site | Google Scholar
K. Noda, S. Nakao, S. Ishida, and T. Ishibashi, “Leukocyte adhesion molecules in diabetic retinopathy,” Journal of Ophthalmology, vol. 2012, Article ID 279037, 6 pages, 2012.
View at: Publisher Site | Google Scholar
H. Song, L. Wang, and Y. Hui, “Expression of CD18 on the neutrophils of patients with diabetic retinopathy,” Graefe's Archive for Clinical and Experimental Ophthalmology, vol. 245, no. 1, pp. 24–31, 2007.
View at: Publisher Site | Google Scholar
A. M. Joussen, V. Poulaki, M. L. Le et al., “A central role for inflammation in the pathogenesis of diabetic retinopathy,” FASEB Journal, vol. 18, no. 12, pp. 1450–1452, 2004.
View at: Publisher Site | Google Scholar
C. Costagliola, A. Daniele, R. dell’Omo et al., “Aqueous humor levels of vascular endothelial growth factor and adiponectin in patients with type 2 diabetes before and after intravitreal bevacizumab injection,” Experimental Eye Research, vol. 110, pp. 50–54, 2013.
View at: Publisher Site | Google Scholar
A. Hossain, D. Heron, I. Davenport et al., “Protective effects of bestatin in the retina of streptozotocin-induced diabetic mice,” Experimental Eye Research, vol. 149, pp. 100–106, 2016.
View at: Publisher Site | Google Scholar
A. M. Joussen, V. Poulaki, W. Qin et al., “Retinal vascular endothelial growth factor induces intercellular adhesion molecule-1 and endothelial nitric oxide synthase expression and initiates early diabetic retinal leukocyte adhesion in vivo,” The American Journal of Pathology, vol. 160, no. 2, pp. 501–509, 2002.
View at: Publisher Site | Google Scholar
S. Doganay, C. Evereklioglu, H. Er et al., “Comparison of serum NO, TNF-alpha, IL-1beta, sIL-2R, IL-6 and IL-8 levels with grades of retinopathy in patients with diabetes mellitus,” Eye (London, England), vol. 16, no. 2, pp. 163–170, 2002.
View at: Publisher Site | Google Scholar
S. Sharma, S. Saxena, K. Srivastav et al., “Nitric oxide and oxidative stress is associated with severity of diabetic retinopathy and retinal structural alterations,” Clinical & Experimental Ophthalmology, vol. 43, no. 5, pp. 429–436, 2015.
View at: Publisher Site | Google Scholar
X. Chen, L. Feng, and H. Jin, “Constant or fluctuating hyperglycemias increases cytomembrane stiffness of human umbilical vein endothelial cells in culture: roles of cytoskeletal rearrangement and nitric oxide synthesis,” BMC Cell Biology, vol. 14, no. 1, article 22, 2013.
View at: Google Scholar
A. M. A. El-Asrar, S. Desmet, A. Meersschaert, L. Dralands, L. Missotten, and K. Geboes, “Expression of the inducible isoform of nitric oxide synthase in the retinas of human subjects with diabetes mellitus,” American Journal of Ophthalmology, vol. 132, no. 4, pp. 551–556, 2001.
View at: Publisher Site | Google Scholar
E. C. Leal, A. Manivannan, K. Hosoya et al., “Inducible nitric oxide synthase isoform is a key mediator of leukostasis and blood-retinal barrier breakdown in diabetic retinopathy,” Investigative Ophthalmology & Visual Science, vol. 48, no. 11, pp. 5257–5265, 2007.
View at: Publisher Site | Google Scholar
M. A. Rosales, K. C. Silva, D. A. Duarte et al., “S-nitrosoglutathione inhibits inducible nitric oxide synthase upregulation by redox posttranslational modification in experimental diabetic retinopathy,” Investigative Ophthalmology & Visual Science, vol. 55, no. 5, pp. 2921–2932, 2014.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2017 Wenpei Chen et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

1536

Downloads

941

Citations